Трикотажная одежда для дома и отдыха для мужчин и женщин, в интернет магазине Ирис — домашний трикотаж!

Домашний трикотаж от производителя в Иваново, в интернет-магазине «Ирис — домашний трикотаж» Трикотаж дешево, купить ночные сорочки, купить туники, купить трикотаж

Разное

Сгущенное молоко при диете: От сгущенки худеют…?

Содержание

Сгущенка алексеевская вред и польза. Сгущенное молоко (сгущенка)

Сгущенка — удивительное лакомство, непревзойденный вкус которого знаком многим россиянам с раннего детства. Маленькие детки готовы кушать ее целыми ложками. Впрочем, как и некоторые взрослые. Но, оказывается, так делать нельзя. Ведь как и любая другая сладость, имеет свои как полезные свойства, так и противопоказания. Диетологи рекомендуют его употреблять в количестве до 2 ст. ложек в сутки, не больше. По их словам, чрезмерное поедание лакомства может причинить серьезный вред организму. Но обо всем по порядку.

Немного из истории

Прежде чем говорить о вреде и пользе сгущенного молока, позвольте рассказать чуть-чуть об истории его происхождения. Принято считать, что лакомство это было придумано в СССР во времена дефицита различных продуктов. Однако это неверно! Рецепт на самом деле появился еще в начала 19 века. Его создателем стал француз Аппер. Однако запатентовать свое изобретение ему не удалось. Зато это получилось у Питера Дюранта. Кстати, именно этому человеку также принадлежит идея использования для хранения лакомства специальных жестяных банок.

Однако в те времена сгущенное молоко все еще не имело привычного аромата и вкуса. Их оно приобрело в 1826 году, благодаря хитроумному предпринимателю Гейлу Бордену. Именно его работники на заводе стали впервые создавать сгущенку путем выпаривания с тростниковым сахаром. Впрочем, некоторые ученые оспаривают подобные сведения. Они утверждают, что право на изобретение продукта принадлежит жителям Индии. Якобы они знали, как его создавать, еще 5000 лет тому назад.

В России сгущенка появилась спустя почти 60 (5000?!) лет после изобретения. Случилось это в 1881 году. Постепенно она настолько полюбилась нашим соотечественникам, что те позаимствовали рецепт и стали по нему готовить. Причем не только на заводах, но и в домашних условиях. И вот результат — сегодня многие уверены, что это удивительное лакомство было изобретено русскими. Но… увы и ах!

Хорошая сгущенка — какая она?

Есть один момент, который хотелось бы уточнить, прежде чем рассказывать о вреде и пользе сгущенного молока для организма. Звучит он так: сгущенка на рынке сегодня представлена разная, да вот только не вся она целебна. Хитроумные производители наловчились добавлять в состав разные растительные жиры и загустители. При этом они на этикетке ставят обозначение ТУ. Так вот, мимо такого продукта лучше проходить, он никак не может называться полезным. Поскольку в состав сгущенки не должно входить ничего, кроме сахара и молока. И иногда еще — кофе, какао или сливок.

Чтобы не ошибиться с выбором, можно обращать внимание на этикетку, наклеенную на жестяную или мягкую упаковку. На ней должно быть четко указано, что качество сгущенки соответствует ГОСТ 2903-78 — для России, либо для Украины — ДСТУ 4274:2003. А также написано, что это «Молоко цельное сгущенное с сахаром». Никак иначе продукт называться не может. И еще один такой момент: не забывайте смотреть на дату изготовления, лакомство не должно быть просроченным. Если дома вы заметили, что на его поверхности имеются пузырьки или пенка непонятного цвета, выбросьте. Здоровье дороже всяческих денег!

Польза сгущенного молока с сахаром

Если вам удалось заполучить качественный продукт, знайте: вы не прогадали. Он гораздо полезнее любых других лакомств, таких как: мармеладки, шоколадки, йогурты и так далее. Поскольку в его состав входит большое количество полезных веществ, среди которых можно отметить особо:

  • кальций — способствует укреплению костной структуры и зубов;
  • витамин D — помогает дольше не стареть, укрепляет кости;
  • калий и магний — нормализуют работу сердца и сосудов;
  • фосфор — необходим для хорошего кровообращения;
  • витамин C — позволяет укрепить иммунитет;
  • глюкоза — способствует восстановлению сил;
  • и так далее.

Кроме того, сгущенку рекомендуется употреблять для нормализации гормонального фона, увеличения лактации (кормящей маме!), восполнения запаса минералов и витаминов, улучшения общего самочувствия, улучшения зрения, активного набора мышечной массы (полезно для бодибилдеров!)

Правила употребления

Говорить о пользе сгущенного молока можно лишь в том случае, если вы будете его правильно употреблять. Чрезмерное поедание лакомства, как и любых других сладостей, ни до чего хорошо довести не может. Поэтому диетологи и врачи рекомендуют воздержаться от этого. Как уже говорилось выше, разрешенное количество — не более 2 ст. ложек в сутки для взрослых и 2 чайных для маленьких детей старше 2-3 лет. Лучше всего добавлять в чай, кофе или просто в водичку (для малыша!). Либо сочетать с какими-либо фруктами (например, бананами или киви). Мазать на батон можно, но при этом важно стараться не превышать дозировку.

Правила хранения

Пользы от сгущенного молока будет тем меньше, чем дольше оно будет храниться. А если это делать неправильно, польза сведется на нет. Производители рекомендуют сразу после покупки убирать лакомство в холодильник. После открытия его можно хранить не дольше 12 месяцев, при температуре от 0 до +10 градусов, если оно находится в жестяной банке. В мягкой упаковке его нельзя хранить более 3 месяцев. При покупке сгущенки на розлив срок ее употребления ограничивается пятью месяцами. Если, открыв продукт, вы увидите в нем комочки, кристаллики или плесень, его необходимо немедленно выбросить. Поедание испортившегося лакомства очень вредно для вашего здоровья.

Вред сгущенки для здоровья человека

Недостаток сгущенного молока в том, что при изготовлении в него добавляют много сахара. Конечный продукт получается высококалорийным и жирным. Поэтому в больших количествах его потреблять запрещено, особенно малым деткам. Кроме того, от лакомства желательно отказаться людям, страдающим от избыточного веса, сахарного диабета, аллергии на молоко или сахар. А также тем, кто заботится о здоровье своих зубов и стройности фигуры. Поскольку чрезмерное употребление сладкого может привести к развитию кариеса и патологическому ожирению.

Польза и вред кофе со сгущенным молоком

Отдельного внимания заслуживает употребление кофе со сгущенкой. С одной стороны, такой напиток весьма полезен, так как в нем содержится, кроме витаминов с минералами, 30 органических кислот. Благодаря этому лакомство способно оказывать стимулирующее, нормализующее, успокаивающее действие на организм. Ежедневное питье позволяет избавиться от депрессии и плохого настроения, улучшает самочувствие.

С другой, кофе со сгущенным молоком способен привести к повышению холестерина в крови, головокружениям, бессоннице и головной боли. Впрочем, чтобы всего этого не провоцировать, достаточно употреблять не более 2 чашек напитка ежедневно. С осторожностью следует пить лакомство людям, страдающим от заболеваний почек, ишемической болезни сердца, гипертонии, атеросклероза или глаукомы. А также детям до 14-16 лет и беременным женщинам.

Видео от специалистов: о пользе сгущенки

Рецепт домашней сгущенки

Сгущенное молоко будет максимально полезным, если вы сделаете его дома, своими руками. Это не так сложно, как может показаться. Нужно лишь запастись литром свежего домашнего молока и стаканом сахара (можно заменить сахарной пудрой). Из посуды понадобится кастрюля из нержавейки и ложка (лучше деревянная!) Когда все будет подготовлено, можно перейти к приготовлению лакомства.

Последовательность действий такова:

  1. Налить молоко в кастрюлю и поставить на медленный огонь.
  2. Вскипятить его. Сразу отлить из посуды около 1 ст. жидкости.
  3. В стакане с горячим молоком растворить весь имеющийся сахар, перемешать.
  4. Вылить смесь обратно в кастрюлю, продолжить варить на маленьком огне.
  5. В течение всей варки помешивать будущее лакомство, чтобы не подгорело.
  6. Как только от его первоначального объема останется 1/3 (именно столько, это важно!), а само оно приобретет слегка кремовый оттенок, сгущенное молоко перелить в стеклянную банку.
  7. Чуть остудить и убрать в холодильник на верхнюю полку на ночь.
  8. К утру сгущенка уже будет достаточно вязкой, ее можно кушать.

Обратите внимание! Варить молоко с сахаром следует не дольше 35-40 минут. Очень важно не передержать его, иначе вместо сгущенки вы получите карамель. При этом выпарить не полностью тоже нельзя, иначе жидкость не сможет приобрести нужную вязкость. Поэтому следите внимательно, что у вас творится в кастрюле.

В качестве заключения!

Теперь вы знаете все об истории, правиле выбора, пользе и вреде сгущенного молока с сахаром. А также о том, как его можно приготовить в домашних условиях. Желаем вам приятного чаепития, не болейте!

Из-за популярности товара польза и вред сгущенки являются важным вопросом для покупателя. В данной статье рассматривается все, что касается сгущенного молока: свойства, особенности употребления, польза, вред, противопоказания.

Что такое сгущенка

Сгущенка – полезный продукт питания, состоящий из смеси молока и сахара. Делается сгущенка путем выпаривания или концентрирования молока. В состав жидкости также добавляют 11% сахара, за счет чего она достигает однородной консистенции. По цвету бывает белая и коричневая.

Состав и калорийность сгущенки

Польза и вред сгущенки для здоровья обусловлены ее химическим составом. По ГОСТ в сгущенку должны входить молочные жиры – 8,6%.

Витамины класса B и витамины A, D, PP, C, E, H.

Полезные минеральные вещества:

  • железо;
  • магний;
  • сера;
  • фосфор;
  • калий;
  • кальций;
  • селен.

В стандартной банке 1220 ккал (330 ккал на 100 граммов).

Полезные свойства сгущенки

Полезные свойства сгущенки объясняются огромным количеством минералов и витаминов. Если есть ее каждый день в малых количествах (100 граммов), иммунитет организма укрепится уже через несколько дней.

Польза сгущенного молока в умеренном количестве не преувеличена, а вот если съедать целыми банками, то только во вред себе.

Важно! Сгущенка хорошо восстанавливает организм после долгих физических или умственных нагрузок.

Калий положительно влияет на работу сердечно-сосудистой системы, а хлор избавляет от отеков.

Сгущенка полезна, почти так же, как и молоко, зато, если ее сварить, она намного быстрее усваивается организмом. Для зрения, зубов и костных тканей она тоже принесет пользу.

Можно ли сгущенку беременным и кормящим женщинам

Диетологи во время беременности запрещают есть много сладостей, и сгущенка не исключение. Поэтому 100 граммов в день более чем достаточно. Она может обеспечить организм полезными минералами и витаминами, а также укрепить иммунитет.

Во время кормления за один день больше двух чайных ложек сгущенки есть вредно. Ведь все, что ест мать, попадает с молоком в организм ребенка. При проблемах с желудком у ребенка матери лакомство противопоказано, так как оно может вызывать газообразование и причинить малышу вред.

Польза от его употребления есть, но основной причиной ограничения в обоих случаях является содержание в большой концентрации сахарозы. Так что полезным молочный десерт будет только в малых количествах.

При сахарном диабете про сгущенку лучше забыть.

Замечание! В одной банке сгущенки 1220 ккал. Во время кормления грудью она приводит к набору веса матери и негативно сказывается на здоровье ребенка.

С какого возраста сгущенку можно давать детям

По сравнению с конфетами и шоколадками, которые приносят только вред, эта сладость полезнее по причине отсутствия в ней красителей и усилителей вкуса. Ребенку употреблять ее можно с 3–4 лет. Но только в малых порциях: не более 100 граммов в день. Если больше, то это уже не польза, а вред, из-за которого ребенку в будущем будут обеспечены кариес, сахарный диабет и ожирение. А вот концентрированное молоко детям никакой пользы не принесет.

Сгущенка при гастрите и панкреатите

Разрешение есть сладости при гастрите зависит от стадии развития. На последней стадии есть сгущенку нельзя из-за ее жирности.

При любой другой стадии ее употребление разрешено, и польза для организма будет, только если есть ограниченными порциями.

При панкреатите тоже следует различать периоды обострения и ремиссии. Так как во время обострения панкреатита поджелудочная железа уязвима и требует покоя и исключения нагрузок, употреблять сгущенку в это время вредно.

В период устойчивой ремиссии панкреатита следует ограничивать жиры и углеводы, поэтому есть сгущенное молоко тоже вредно.

Если очень хочется, 100 граммов сгущенки съесть можно, но лучше не стоит.

Самой распространенной причиной запрета этого продукта во время болезней и не только являются не столько калорийные свойства и высокая концентрация сахара, сколько способ изготовления товара производителями. В случае выбора подделки сгущенное молоко может принести не пользу, а вред для здоровья организма.

Сгущенное молоко при подагре есть можно и нужно, потому что оно относится к ощелачивающим продуктам и его наличие в рационе обязательно. Поэтому польза от свойств этого лакомства очевидна.

Сгущенка при похудении

Важно! Калорийные свойства сгущенки совершенно не подходят людям, которые сидят на диете или следят за здоровым питанием.

Данный продукт во время похудения употреблять можно, но только в строго ограниченных порциях. При здоровом питании или диете употреблять больше 2 чайных ложек в день не позволительно. Одной банки достаточно, чтобы вмиг набрать 1220 калорий. Лучше добавлять лакомство в чай, кофе или какао вместо сахара.

Как приготовить сгущенку в домашних условиях

Быстро приготовить сгущенку сможет каждый. На весь процесс потребуется всего 15 минут. Несмотря на быстроту готовки, все свойства соответствуют магазинным. Также она дешевле и натуральнее обычной, а пользы от сгущенного молока с сахаром по домашнему рецепту больше. Чтобы все получилось правильно, необходимо следовать инструкции.

В итоге получится порция в 520 мл.

Ингредиенты:

  • 400 г сахарной пудры;
  • 40 г масла;
  • 400 г молока.

Приготовление:

  1. Смешать все ингредиенты и поместить их в кастрюлю.
  2. Включить слабый огонь и мешать жидкость до полного растворения ингредиентов.
  3. Когда жидкость начнет закипать и появится пенка, необходимо прибавить огня и, мешая, варить смесь. Она будет пениться, и, если начнет убегать из кастрюли, надо сделать огонь поменьше.
  4. С момента, когда смесь начала кипеть, варить 11 минут.
  5. После этого охладить кастрюлю в воде до теплой температуры.
  6. Когда однородная масса станет теплой, перелить ее в банку и закрыть. После охлаждения она станет густой и примет привычный вид.

Какая сгущенка полезнее: обычная или вареная

Вареная сгущенка обладает почти такими же свойствами, как и обычная. Но некоторая часть минералов и витаминов теряется при варении.

Основным отличием вареной сгущенки от обычной является высокая питательность и легкость усвоения всех полезных элементов организмом.

В вареном сгущенном молоке находится огромное количество кальция, очень полезного для зубов и костей.

Важно! Полезных веществ в лакомстве так много, что они способны улучшить обмен веществ организма, работоспособность головного мозга, повысить иммунитет, наполнить организм витаминами и полезными веществами.

С чем едят сгущенное молоко

Для комбинирования можно использовать выпечку, а также чай и другие горячие напитки. Любой полезный мучной или злаковый продукт можно сочетать со сгущенным молоком.

Его также добавляют в торты, пирожные, мороженое. Очень вкусным получается торт «Муравейник» со сгущенкой. По утрам можно есть манную кашу со сгущенным молоком.

Вред сгущенки и противопоказания

В сгущенке очень большая концентрация сахара, за счет чего она калорийная и вредная в больших количествах.

Противопоказания:

  • полнота;
  • панкреатит почти на всех стадиях развития;
  • гастрит в последней стадии;
  • сахарный диабет.

Фальсификат может принести только вред. В таких продуктах содержится краситель E171 – едкое вещество, вредные жиры, растительное масло и пищевые добавки, которые ухудшают свойства сгущенки и сильно вредят организму. Поэтому при выборе товара нужно внимательно смотреть на наличие надписи ГОСТ на банке и на состав продукта. Если в нем есть что-то, кроме нормализованного молока и сахарозы, это подделка.

Как выбирать и хранить сгущенку

Для правильного выбора сгущенного молока нужно знать определенные критерии и свойства, по которым можно найти настоящий продукт.

Признаки качественного продукта:

  • Название на этикетке: «Молоко цельное сгущенное с сахаром».
  • Регламент ГОСТа 2903-78 и ГОСТ Р53436-2009.
  • Выбор производителя: чем крупнее и авторитетнее производитель, тем лучше.
  • Состав и свойства: кроме сахара и молока ничего быть не должно, если есть, то это подделка, от которой будет только вред.
  • Металлическая банка в синей обертке. Битые или изогнутые банки лучше не брать.
  • После вскрытия банки нужно обратить внимание на свойства: наличие комков сахара – это подсластитель; неестественный цвет означает наличие вредных компонентов.
  • Если сгущенка выглядит неоднородно, молока в ней мало.
  • Не забывать про срок годности.

Хранить сгущенку можно несколько месяцев в сухом месте. Для долгого хранения больше подойдет холодильник. Там она простоит целый год.

Заключение

Благодаря ценным свойствам польза и вред сгущенки неравнозначны. Продукт богат полезными веществами, поэтому рекомендован для здорового питания. Но калорийность ограничивает употребление лакомства до 100 граммов в день. При наличии заболеваний ЖКТ и ожирения молочный десерт лучше исключить из рациона: пользы он принесет мало, а вот вред причинить может существенный.

Была ли Вам данная статья полезной?

Трудно найти человека, который не любил бы сгущенку. Даже заядлые приверженцы различных диет иногда позволяют себе съесть ложечку другую этого сладкого молочного десерта. А некоторые едят банками, даже не задумываясь о последствиях. К сожалению не всем известно, что дневная норма употребления сгущенного молока с сахаром — две столовые ложки. И то, делать это лучше в сочетании с другими продуктами, блинчиками запивая все несладким чаем. О пользе и вреде вы узнаете из этой статьи.

Это — рекомендации не только диетологов, но и врачей. С чем они связаны, и почему нельзя есть много? Ведь это — натуральный продукт, который даже можно использовать в качестве детского питания. В нем содержатся все те же полезные микроэлементы и витамины, что и в коровьем молоке. К тому же — глюкоза тоже никому еще не навредила.

Так кому же доверять в вопросе потребления сгущенного молока? Диетологам, или заядлым поклонникам этого продукта. Далее постараемся разобраться подробнее, в чем же заключается вред сгущенки, и имеет ли она хоть какую-то пользу. А заодно — рассмотрим случаи, при которых этот популярный продукт и вовсе противопоказан.

Свойства продукта

Настоящая сгущенка, приготовленная по ГОСТу должна содержать в себе только натуральное коровье молоко, сахар и в некоторых случаях — воду. В данном случае сахар сам по себе является консервантом.

В то же время сахар значительно добавляет калорий этому продукту. Для общего развития, сгущенное молоко с сахаром содержит:

  • белки — 7.2 гр.;
  • жиры — 8,5 гр.;
  • углеводы — 56,0 гр.

Калорийность продукта — 323 ккал.

Из этого можно сделать вывод, что продукт содержит в себе большое количество простых углеводов, при их большом потреблении способных приводить к быстрому ожирению и повышению уровня сахара в крови. И это – не преувеличение. Сгущенное молоко действительно очень сладкое и жирное. Многие кондитерские изделия не могут сравниться с ней по этим показателям.

К тому же, сгущенка — продукт высококалорийный, а это — еще одна причина не есть ее в больших количествах.

Польза сгущенки

Прежде чем подробно обсудить вред сгущенки для организма, стоит, все таки упомянуть о её полезных свойствах. Во-первых, она содержит большое количество витаминов и полезных микроэлементов. Это витамин А, Фосфор, Калий, Натрий, Кальций, Магний и Фтор.

Кальций укрепляет костные ткани, витамин А улучшает зрение. Кроме того – в натуральном сгущенном молоке содержится большое количество глюкозы, которая активно восстанавливает силы после тяжело перенесенных болезней. По сути, сгущенка имеет те же полезные свойства, что и обычное коровье молоко. К тому же, для многих она усваивается намного легче, чем сырые молочные продукты. Ведь известно, что далеко не все способны нормально переварить стакан обычного молока.

В случае со сгущенкой, достаточно разбавить в стакане кипяченой воды столовую ложку продукта, и можно получить вкусный и полезный напиток с теми же полезными веществами, что и у обычного молока. Но усвоится он намного легче.

Тем не менее, даже разбавленная сгущенка имеет большую калорийность, чем сырье в виде молока. Кроме того – в нем содержится много сахара. Потому не нужно забывать про аллергические реакции, которые может вызвать продукт и о его вреде для людей, страдающих избытком лишнего веса и сахарным диабетом.

Вред сгущенки для организма

Если бы все было так хорошо, то все ели бы этот продукт банками даже не задумываясь о последствиях. Тем не менее многие усвоили с детства, что много сгущенки есть нельзя. Родители нам говорили, что чрезмерное употребление сладкого лакомства означает скорый поход к стоматологу.

Сочетание высокого количества сахара и молочных кислот приводит к усиленному образованию бактерий в ротовой полости, и, как следствие — к появлению кариеса. Это — первая причина для того, чтоб не есть сгущенку ложками.

Вторая причина – высокая калорийность. Как известно, потребляемые калории нужно как-то сжигать. Если спортсмен перед усиленной тренировкой съедает банку сгущенки — в этом нет ничего страшного, он тут же сожжет все калории, при этом нарастит нужную мышечную массу и не утратит силы, нужные для поддержания нормальной жизнедеятельности организма. Но если каждый день употреблять столь калорийный продукт в больших количествах, эти калории преобразуются в лишние жировые отложения.

Сгущенное молоко готовится с сахаром. Это — неизменная рецептура, которая является классической уже не одно столетие. Сахар в данном случае играет роль консерванта. Именно за счет него банка сгущенки может храниться целый год.

Но сахар противопоказан людям с сахарным диабетом и всем, кто страдает ожирением. Потому есть сгущенку таким больным запрещают не только диетологи, но и врачи. Если пренебрегать данными рекомендациями, это может привести к фатальным последствиям.

Таким образом, много сгущенки нельзя есть и детям. Для маленьких организмов необходимость перерабатывать сахар в больших количествах может вылиться в начало аллергических реакций. Диатез на щечках после активного поедания сгущенки – не редкость. Не говоря уже о проблемах с зубами и лишним весом.

Можно ли сгущенку кормящей маме

При беременности можно употреблять практически все продукты питания. Главное – чтоб их количество было умеренным. Это же касается и сгущенного молока. Беременным женщинам можно и даже нужно употреблять полезные молочные продукты, как и всем остальным. Суточная норма сгущенного молока для беременных – 1 столовая ложка. Никакого вреда она принести не может.

Что касается употребления сгущенки во время кормления грудью, то маммологи, педиатры и гинекологи этот продукт даже рекомендуют. Но только в виде чая. То есть — травяной или зеленый чай, в котором разбавлена 1 чайная ложка сгущенки увеличивает лактацию и прибавляет жизненные силы для молодой мамы.

Какой продукт содержится в банке

Не стоит забывать о том, что сгущенка на отечественном рынке — самый подделываемый продукт. Именно этот фактор нередко приводит к наименее приятным последствиям употребления её в больших количествах.

Многие производители натуральные молочные жиры часто заменяют пальмовым или кокосовым жиром. Как известно, он активно откладывается на стенках сосудов и приводит к образованию тромбов.

Недобросовестные изготовители часто добавляют в продукт консерванты, белила, красители, загустители, химические вещества, использование которых запрещено министерством здравоохранения РФ. К сожалению, их наличие в молочных консервах указывается далеко не всегда. Потому покупать следует только проверенный продукт, в качестве которого не возникает сомнений.

Банка натурального сгущенного молока не может стоить значительно дешевле 45 р. Если дороже — ничего страшного, а вот цена банки равная 25-30 рублям должна настораживать.

Кроме того, особое внимание следует уделять такому моменту, как свежесть продукта. И дело не только в том, что просроченная сгущенка может иметь неравномерную структуру и неприятный оттенок.

Часто внутри банки просроченные молочных консервов образуется плесень. Она представляет собой патогенный грибок, способный привести к серьезному отравлению и другим проблемам со здоровьем.

Вздутую банку следует без колебаний выбросить. Нарушение формы упаковки свидетельствует о том, что внутри нее начали размножаться болезнетворные микроорганизмы.

Сгущенное молоко – это сладкий, вкусный и любимый всеми детьми продукт. Состав сгущенного молока довольно прост — сахар и коровье молоко. В последнее время сгущенное молоко стали продавать в разнообразной таре: в жестяных 400-граммовых банках, в пластиковых и стеклянных банках, в тубах и жестких пакетах.

Калорийность сгущенного молока очень высока – 320 ккал на 100 г продукта. При этом в сгущенке содержится 34% белка.

Сгущенное молоко употребляют в пищу как самостоятельный сладкий продукт, а также добавляют в выпечку, чай и кофе.

Польза сгущенного молока

Сгущенка обладает всеми полезными качествами коровьего молока. Если она сделана качественно, организм полностью усваивает ее и обогащается содержащимися в ней полезными веществами.

Кальций способствует укреплению костей, ногтей и зубов, улучшает зрение. Помимо кальция в сгущенке содержатся соли фосфора, которые отвечают за деятельность мозга и восстановление крови.

Вред сгущенного молока

Употребляя сгущенку важно помнить о чувстве меры. Употребление больше 3 ложек в день может привести к развитию ожирения, сахарному диабету и кариесу.

Польза и вред сгущенного молока напрямую зависят от состава этого продукта. Как же не ошибиться и выбрать приятное лакомство, а не опасную подделку? Прежде всего, стоит обратить внимание на название. «Цельное сгущенное молоко с сахаром» — такое название у сгущенки согласно ГОСТа. Жирность сгущенки не должна быть ниже 8.5%. В составе сгущенного молока допустимы только коровьи жиры. Стоит остерегаться, если в состав сгущенки входит пальмовый жир — такой продукт точно не поспособствует вашему здоровью. Если при открытии сгущенки была обнаружена неоднородность структуры – комочки, ее лучше выкинуть, она может быть слишком опасна для здоровья.

Статьи по теме:

Чем полезна черная икра?

Высокая стоимость черной икры уже сама по себе подразумевает несомненную пользу этого деликатеса. Наша статья расскажет, чем полезен этот продукт и какие полезные вещества он содержит.

Салака — польза и вред

Салака достаточно популярная рыба, во многом благодаря невысокой стоимости и содержанию в ней полезных веществ. Более подробно о пользе и возможном вреде этой рыбы мы расскажем в нашей статье.

Ливерная колбаса — польза и вред

Если при изготовлении ливерной колбасы были соблюдены все правила и использованы продукты высокого качества, то в ее пользе сомневаться не приходится. Эта статья расскажет о пользе ливерной колбасы и о том, что ее делает вредной.

Сгущенное молоко – калорийность

Сгущенное молоко любят не только дети, но и взрослые. Эта статья расскажет о калорийности сгущенки, полезных свойствах этого продукта и возможном вреде от его употребления.

Сгущенка с сахаром — продукт, в который превращают свежее молоко, не менее популярный что творог, масло и сыр. Излюбленное лакомство взрослых и детей, место которому найдется в высокой и в домашней кухне.

Непревзойденный вкус и польза сгущенки

Для приготовления сгущенки из молока продолжительное время выпаривают при определенной температуре влагу, сгущают его до состояния однородной кремово-белой тягучей массы.

В зависимости от деталей конкретной технологии изготовления и возможном использовании дополнительных ингредиентов, в конечном итоге могут быть получены несколько разновидностей сгущенки.

Концентрированное молоко без каких бы то ни было добавок;

Сгущенное молоко произведенное с добавлением исключительно сахара;

Сгущенное молоко с добавлением кофе или какао;

Сгущенка с цикорием и сахаром.

Последний продукт характеризуется сладким вкусом с характерной горчинкой привкуса цикория и оттенком его аромата. Употребляют его аналогично сгущенке с какао и кофе.

Еще сгущенку классифицируют по жирности.

В обезжиренной доля жиров не должна превышать 1 %;

Классическая сгущенка содержит их примерно 8,5 %;

Сгущенные сливки достигают жирности в 19 %.

По консистенции она делится на простую и вареную — первую можно с ложки лить, а вторая очень густая.

Опыты по консервации молочных продуктов начались еще в конце XVIII века, но только в 1856 году американский промышленник Гейл Борден запатентовал изобретение сгущенного молока и еще через каких-то тридцать лет сгущенка вошла в числе самых востребованных продуктов в мире.

Сгущенное молоко с сахаром едят как лакомство в чистом виде, делают ее ингредиентом для коржей тортов, печенья и иной выпечки, готовят с ней кремы и десерты, добавляют ее в чай и кофе, дополняют ей блинчики и фруктовые салаты.

Сгущенное молоко с кофе или какао используют аналогичным образом и разводят водой для напитков.

Простое концентрированное молоко без добавок востребовано как полноценный заменитель молока свежего — можно сварить на нем кашу, поставить тесто, приготовить подливу к мясу.

Как правило, сгущенку изготавливают из коровьего молока, но также ее можно получить из молока козьего. Опыты по приготовлению сгущенного молока с сахаром в домашних условиях обычно успешны. Но гораздо чаще хозяйки берутся за превращение сгущенки магазинной в сгущенку вареную, для чего сгущенку с сахаром проваривают несколько часов в кастрюле на плите.

Большинство полезных свойств сгущенного молока прямо проистекают из аналогичных характеристик свежего молока, ведь оно, превращаясь в сгущенку, практически, ни одной из них ни лишается.

Так, в ней сохраняются витамины A, C, E, H, PP и витамины группы B, а также высоки показатели содержания ряда макро- и микроэлементов — железа, йода, калия, кальций, кобальта, магния, марганца, меди, натрия, селена, серы, фосфора, фтора, хлора, холина и цинка.

Один из главных элементов молочных продуктов — кальций, в союзе с витамином D активно участвует в формировании и укреплении костной ткани, включая челюсти и зубы.

Как еще проявляется польза сгущенки

Благодаря тому, что сгущенка хорошо и полностью (в отличии от молока!) усваивается организмом человека, ее положительного влияния не приходится долго ждать.

Добавление сгущенного молока в регулярное десертное меню положительно сказывается на обмене веществ, восстановлении энергии тела и тонуса мышц после интенсивных физических нагрузок и затяжных болезней, не исключено и ослабление проявлений хронических заболеваний.

Одна ложка сгущенного молока в день значительно укрепляет иммунитет.

Глюкоза, которой в сгущенке в избытке, усиливает деятельность мозга и помогает запоминать, усваивать и анализировать новую информацию, так что сгущеное молоко можно рекомендовать учащимся и ученым.

Кроме того, сгущенка влияет на следующие аспекты здоровья:

Поддерживает работу сердечно-сосудистой системы;

Улучшает зрение и снижает утомляемость глаз за монитором компьютера;

Нормализует гормональный фон, предотвращая его сбои;

Способствует обновлению крови.

Исключительна польза сгущенки и для кормящих матерей. Всего ложечка сгущенного молока в день способствует усилению лактации, при этом не вызывая ни капли сомнений в безопасности такого обогащения рациона мамы для малыша, чувствительного ко всему, что происходит с ее организмом.

Если сравнить ассортимент на воображаемой витрине, среди пирожных, конфет и прочих десертов, то пользу сгущенки не с чем будет сравнить — она самое полезное лакомство, не содержащее дрожжей, красителей и ароматизаторов, стабилизаторов и прочих хитрых добавок.

Она, наконец, не хуже шоколада улучшает настроение, способствуя выработке эндорфинов (гормонов радости).

Важно отметить, что все вышесказанное относится лишь к натуральному сгущенному молоку, произведенному без таких излишеств, как ароматизаторы, эмульгаторы и прочее.

Вред сгущёнки — чем она опасна и кому нельзя ее есть

Важно помнить о том, что сгущенка — не амброзия и у нее есть свои недостатки.

Главные из них — потрясающе высокое содержание сахаров и калорий.

Если на 100 г сгущенного молока с сахаром приходится 320 ккал, то на стандартную банку с сине-белой этикеткой уже вся 1200 ккал. Что уж говорить, к примеру, о калорийности торта, прослоенного сгущенкой со сливочным маслом!

Поэтому диетологи настаивают на разумном, умеренном употреблении сгущенки и блюд, приготовленных с ней.

Но если говорить о концентрированном молоке без добавок вообще, его энергетическая ценность весьма умеренна — всего 75 ккал на 100 г продукта.

Всеми подслащенными видами сгущенки не стоит увлекаться людям склонным к полноте и тем, кто активно занимается спортом, чтобы подкачать мышцы и удержать вес в норме.

Избыток сахара в ее составе противопоказан больным сахарным диабетом.

И он же, в сочетании с молочными кислотами, при регулярном употреблении сгущенного молока провоцирует ухудшение состояния зубной эмали и развитие кариеса. Поэтому, после угощения сгущенкой разумно чистить зубы или хотя бы прополаскивать водой полость рта.

Вред сгущёнки — как избежать его, выбрав качественный продукт и соблюдая условия хранения

Помимо известных всем жестяных банок, сгущенку также выпускают в пластиковых пакетах, стеклянной и пластиковой таре, но это все — для заводского выпуска, а еще ее можно купить на разлив.

Согласно ГОСТу, настоящая сгущенка состоит только из молока с сахаром и не может называться иначе как «Молоко цельное сгущенное с сахаром». Эта маркировка представляется многим свидетельством отличного качества сгущенки, что, в общем-то, совершенно верно.

Это вовсе не означает, что изготовители, руководствующиеся собственными техническими условиями (маркируются как ТУ) выпускают сгущенку неподобающего качества, но полезно знать разницу между этими обозначениями.

Именно в сгущенке всех сортов со знаком ТУ могут содержаться растительные жиры, эмульгаторы, ароматизаторы, сухое молоко и прочие добавки.

Жестяная банка со сгущенкой не должна быть деформированной, не должна иметь следов ржавчины и ни в коем случае не должна быть вздутой.

Жидкая сгущенка любого вида (простая, с какао) должна быть однородной, без комков.

Крупинки в сгущенном молоке, обнаруженные в небольшом количестве, не означают, что сгущёнка вредна. Но демонстрируют, что до истечения ее срока годности осталось немного, либо что были нарушены условия ее хранения и сгущенка постояла на жаре или на морозе.

Для сохранения пользы и употребления сгущёнки без вреда, важно соблюдение условий ее хранения.

Температура варьируется от 0° до +10-22 °С;

Относительная влажность воздуха не должна превышать 75-85 %;

Срок годности с даты производства, равняется для жестяной тары и пластиковых пакетов 12 месяцев;

Открытую банку сгущенки можно хранить в холодильнике буквально день-два и также непродолжителен (буквально несколько дней) срок хранения сгущенки купленной на разлив.

Сгущенное молоко, польза и вред, как приготовить

Сен-15-2016

Что такое сгущенное молоко?

Что такое сгущенное молоко, польза и вред для организма человека, а так же какие есть у него лечебные свойства и чем конкретно полезен этот продукт для здоровья человека? Эти вопросы часто возникают у тех, кто заботится о своем здоровье, ведет здоровый образ жизни и проявляет интерес к народным методам лечения. И этот интерес понятен. Может в этой статье, в какой-то мере, вы сможете получить ответ на эти вопросы.

Ах какое сладкое слово — «сгущенное молоко». Для многих из нас в детстве оно олицетворяло полное счастье. Мы могли его есть банками (если разрешали) и когда угодно! Да и сейчас нам нередко хочется себя побаловать этим сладким лакомством и с его помощью как бы снова вернуться в безмятежное детство.

Сгущенное молоко придумал в начале XIX века француз Аппер, а впервые в продажу оно поступило в Америке в 1856 году.

В России его начали выпускать на маленьком заводе под Оренбургом в 1881 году. Таким образом, сгущенному молоку уже более 200 лет!

Состав этого продукта очень простой — только молоко и сахар. Сахар растворяют в молоке, а потом длительное время выпаривают при температуре не выше 50 градусов до получения необходимой густоты. В результате получается продукт с содержанием влаги до 26 %, сахара в количестве 43, 5 % и жирностью 8,5 % и более. В одной банке молока содержится 1200 ккал. В сгущенном молоке, согласно ГОСТу, не должно содержаться никаких других компонентов, ведь это продукт детского питания!

Сгущенное молоко разделяется по:

Жирности:

Цельное сгущенное молоко с сахаром — этот классическое сгущенное молоко, использующееся повсеместно в кулинарии, в разговорной речи именно ее называют сгущенкой. В состав продукта входят не менее 8,5% жира и не менее 28,5% сухих веществ молока, с массовой долей белка в них не менее 34%.

Обезжиренное сгущенное молоко с сахаром — этот сгущенное молоко, в состав которого входят не более 1% жира и не менее 26% сухих веществ молока, с массовой долей белка в них не менее 34%.

Составу:

Сгущенное молоко с сахаром — это классическая сгущенка, которая рассматривается в данной статье.

Сгущенное молоко без добавления сахара — этот продукт, как правило, называют концентрированным молоком.

Сгущенное молоко с добавлением какао или кофе — это может быть как настоящее сгущенное молоко с какао или кофе, либо растительно-молочные продукты под названием «Сгущенка и какао» или «Сгущенка и кофе».

Сгущенное молоко с добавлением цикория — сгущенка 7% жирности, в которую помимо всего прочего добавлен цикорий.

Консистенции:

Обычное сгущенное молоко — сгущенка обычной консистенции с сахаром или без, которая рассматривается в данной статье.

Вареное сгущенное молоко — вид сгущенки, имеющий более густую консистенцию и получаемый путем дополнительной термообработки. Вареная сгущенка имеет карамельный привкус и коричневатый цвет.

Полезные свойства:

Сгущенное молоко считается наиболее полезной сладостью, поскольку она содержит много кальция и других полезных минералов и витаминов, но в отличие от других сладких продуктов (пирожных, мармелада, конфет и прочих кондитерских изделий) в ней не содержится дрожжей и пищевых добавок. Таким образом, натуральная сгущенка обладает многими полезными свойствами, присущими свежему молоку.

Полезные вещества, содержащиеся в сгущенке, улучшают работу мозга, укрепляют костную ткань и благоприятно влияют на клеточный обмен. Одним из полезных элементов сгущенного молока является кальций, укрепляющий кости и зубы. Польза сгущенного молока заключается еще и в том, что она восстанавливает кровь, повышает иммунитет, нормализует гормональный фон. Сгущенное молоко в кратчайшие сроки может восполнить в организме человека запас витаминов и минералов, поднять тонус и обеспечить прилив сил.

Но наличие у сгущенного молока полезных свойств совсем не означает, что его нужно есть банками, так как неумеренное потребление сгущенки способно нанести вред организму человека.

Настоящая сгущенка должна быть белого цвета, с легким кремовым оттенком, однородная, густая и иметь сливочный вкус.

Сгущенка, хотя и является консервами, очень требовательна к условиям и сроку хранения. Она должна храниться в холодильнике при температуре от 0 до 10 градусов и не более чем 12 месяцев.

Любое нарушение этих правил (повышенная или пониженная температура хранения), нарушение герметичности упаковки или длительности хранения делает этот продукт непригодным в пищу.

Если, открыв банку сгущенного молока, вы заметите, что оно начало кристаллизоваться, в нем появились комочки или плесень, а сама банка вздутая, — немедленно выбросьте ее! Употребляя в пищу такое испорченное молоко, вы рискуете надолго оказаться на больничной койке и существенно подорвать свое здоровье.

Есть сгущенное молоко диетологи советуют не как самостоятельный продукт, а в сочетании с другими продуктами, например с блинчиками или фруктами, и запивать его несладким чаем.

Знайте меру! Многие из нас привыкли есть сгущенку большими ложками и помногу, а между тем суточная норма употребления в пищу сгущенного молока составляет всего 2 столовые ложки!

Противопоказания:

В сгущенном молоке очень много сахара, и, естественно, оно очень калорийно.

Сгущенное молоко противопоказано:

  • людям с избыточным весом;
  • при ожирении;
  • при сахарном диабете.Чрезмерное употребление сгущенного молока может стать причиной кариеса.

Сгущенка, увы, является самым фальсифицированным молочным продуктом — более двух третей сгущенного молока — подделка!

Согласно ГОСТу настоящее сгущенное молоко называется «Молоко цельное сгущенное с сахаром» и никак иначе называться не может. Если на прилавках магазинов вы увидите баночки с названием: «Сгущенное молоко с сахаром», «Молоко сгущенное» или «Сгущенка с сахаром» (вариантов множество), несмотря даже на знакомую с детства сине-белую этикетку, знайте — перед вами подделка!

В такое сгущенное молоко, для того чтобы его удешевить, вместо натурального молочного жира добавляют различные растительные жиры, например пальмовое масло, которое вредно для организма человека, а также различные пищевые добавки.

При лабораторном исследовании в некоторых видах сгущенного молока был обнаружен белый краситель Е171 — диоксид титана, очень ядовитое вещество, которое применяют при изготовлении красок (титановые белила), при производстве изделий из керамики и солнечных аккумуляторов.

Кроме того, настоящее сгущенное молоко должно быть упаковано только в жестяные банки, никакая другая упаковка — пластиковые тубы, стаканчики и т. п. — не допускается.

Чтобы максимально уберечь себя от подделок и не причинить вреда своему организму, внимательно читайте этикетку. Помните, если в состав продукта, кроме молока и сахара, входит что-либо еще — это вредный продукт!

Как выбрать в магазине:

Для того чтобы приобрести баночку настоящего сгущенного молока, нужно обращать при покупке внимание на такие моменты:

Название. Оно должно начинаться со слова «Молоко», а не со слов «сгущенное», «вареное», «настоящее», «сгущенка» – эти и подобные слова в названиях должны вас насторожить.

Под словом «молоко» идет расшифровка «цельное сгущенное с сахаром».

На этикетке нужно внимательно изучить состав. Если продукт настоящий, он соответствует ГОСТ 2903–78 – для России, ДСТУ 4274:2003 – для Украины. Это указывается на банках или мягких упаковках, в которых сейчас не запрещено выпускать данный продукт.

Аббревиатура ТУ на упаковке указывает на то, что производство соответствует техническим условиям, но в составе есть растительные жиры. А как мы знаем, их не должно быть в настоящем сгущенном молоке.

В состав неподдельного продукта входит только сахар и цельное коровье молоко, без каких-либо «ешек»: загустителей, стабилизаторов, красителей, растительных жиров, крахмала.

Эти простые правила помогут выбрать настоящую полезную сгущенку. Также сегодня можно встретить разновидности сгущенки с добавлением какао, кофе, со сливками и стерилизованное.

Согласно ГОСТу, они имеют такие «правильные» названия, которые помогут отличить от подделок:

«Какао с молоком цельным сгущенным с сахаром»,

«Кофе натуральный со сгущенным молоком и сахаром»,

«Сливки сгущенные с сахаром»,

«Молоко сгущенное стерилизованное в банке» (продукт без сахара).

Следует знать, что открытое сгущенное молоко может храниться не более 5 суток.

Рецепт приготовления сгущенного молока в домашних условиях

Для приготовления домашней сгущенки потребуется всего два ингредиента, кастрюля, ложка и примерно полтора часа времени. Молоко и сахар нужно брать в следующих пропорциях:

  • Молоко — 1 литр;
  • Сахар — 1 стакан.

Когда вы будете покупать молоко, обратите внимание на срок его хранения, он не должен быть большим. Также постарайтесь использовать молоко пожирнее (3,5 %), из него сгущенка получается вкуснее.

Для приготовления сгущенного молока следуйте этим указаниям:

  • Молоко наливаем в кастрюлю и ставим на слабый огонь;
  • Нагреваем его почти до кипения и берем из кастрюли примерно 1 стакан молока;
  • В горячем стакане молока растворяем весь сахар;
  • Вливаем молоко с сахаром в кастрюлю и продолжаем держать ее на медленном огне;
  • Убавляем огонь до минимального, когда масса начнет кипеть;
  • Постоянно помешиваем молоко, чтобы оно не пригорело к кастрюле;
  • Варим молоко до тех пор, пока от его первоначального объема не останется одна треть. При этом сгущенка начинает приобретать кремовый оттенок. Для этого нужно от 40 минут до 1 часа;
  • Выливаем сгущенное молоко в банку и ставим в холодильник на ночь.

Сначала сгущенка покажется жидкой, но после ночи в холодильнике она становится вязкой.

Чтобы сгущенное молоко имело однородную массу без комочков, было густым и вкусным, необходимо знать небольшие секреты его приготовления:

Сгущенное молоко лучше всего варить в кастрюле из нержавеющей стали: в ней оно не пригорит. Если такой кастрюли нет, то используйте любую другую кастрюлю с толстым дном;

Вместо сахара лучше всего использовать сахарную пудру, именно из магазина, а не домашнюю. Некоторые хозяйки считают, что небольшое содержание крахмала в магазинной сахарной пудре дает сгущенке лучшую консистенцию;

Молоко для сгущенки должно быть свежим. Не используйте стерилизованное молоко, в крайнем случае — пастеризованное;

Внимательно следите за объемом молока. Если ты снимаете кастрюлю с огня до того, как выпарится две трети его части, то сгущенка не будет вязкой, а если вы его передержите, то это будет карамель;

Чтобы приготовить вареное сгущенное молоко, переложите сгущенку в банку и плотно закройте крышкой, опустите в кастрюлю с холодной водой так, чтобы вода полностью покрывала банку. Поставьте кастрюлю на огонь и доведите до кипения ее содержимое. Засеките 2 часа и по их истечении вытащите банку: вареная сгущенка готова.

Поделитесь статьей с друзьями в социальных сетях!

Еще по этой же теме:

Первым кто придумал аппарат для изготовления сгущенного молока с сахаром был североамериканец Гейл Борден в 1858 г. А в 1879 г. в России на маленьком заводе начали выпускать сгущенное молоко.

Сгущенка… У всех при упоминании этого фразы перед глазами возникает жестяная баночка, в которой находится нынешнее лакомство. Для одних — это воспоминания о вкусной выпечке из детства, а кто-то ассоциирует сгущенку с армией, где сгущенное молоко было неотъемлемым добавлением к сухому пайку.

Полезные свойства и калорийность сгущенного молока

Основным составляющим является коровье молоко и сахар, поэтому сгущенное молоко — очень высококалорийный продукт. Она складывается на 8,4 % из насыщенных упитанных кислот, на 33 % из молока. Доля влаги составляет не более 26 %.

В 100 граммах находится жиров (8,7 г), углеводов (53 г), белков (7 г), этот сладкий продукт не рекомендовано людям с сахарным диабетом, а кроме того тем, кто соблюдает диеты. Энергетическая значимость сгущенного молока — 330 ккал на 100 г. Из них 30 ккал — от белков, 80 ккал — от жиров, 219 ккал — от углеводов. Радует то, что в отличие от многих лакомств, сгущенка очень полезна.

Процесс преобразования молока в сгущенку происходит при температуре 55-60 градусов, что не разрушает, а наоборот сохранить максимальное число витаминов, микроэлементов, держащихся в исходном продукте.

Поэтому она не менее полезна, чем цельное молоко. Отличие только в жирности, наличии сахара и в том, что сгущенное молоко лучше усваивается организмом, чем цельное, которое содержит лактозу. Сгущенка может сохраняют свои нужные характеристики микроэлементы и витамины около 1 года.

Настоящая сгущенка замещает молочные продукты, поставляя нашему организму нужные вещества. Все чаще сегодня при производстве сгущенки отступают от стереотипов и готовят её из дешёвого растительного масла и ненатуральных ингредиентов. Такой продукт приносит не выгоду, а ущерб здоровью.

Сгущенное молоко в медицины и косметологии

Если каждый день съедать 1-2 ложки сгущенки, то это хорошо содействует укреплению всей иммунной системы и увеличивает сопротивляемость организма против разных заболеваний.

Минералы и витамины, которые находится в составе, моментально пополняют запасы в организме, что способствует восстановлению сил после насыщенной интеллектуальной либо физической работы. Большое число сбалансированных солей фосфора, которые вступают в состав сгущенного молока, улучшают деятельность нашего мозга и несут ответственность за восстановление крови.

Знаменитый стилист-колорист в Лондоне Леа Харрисон часто в собственной работе применяет сгущенное молоко. Оно предотвращает пересушивание волос и лучше смягчает кожу головы при окрашивании. Мало кто может позволить себе обслуживаться в лондонском салоне, а вот приготовить маску может каждый.

На базе сгущенного молока готовится великолепное средство, что устраняет шелушение кожи. Для этого необходимо взять 1 ст. л. сока сладких плодов (яблоко или крыжовник), добавить 1 ч. л. сгущенного молока. Нанести массу на шелушащиеся участки лица и через 15 мин. смыть горячей водой.

Можно ли сгущенное молоко употреблять при похудении?

Сгущенное молоко — вредная сладость для фигуры. Его не советуют применять более 2 ч. л. в день тем, кто следит за собственным весом. Даже то, что главным его компонентом есть молоко, не спасает всей ситуации. Оно в сгущенке концентрируется и увеличивает его питательность как минимум в 4 раз! Так же в продукте находится сахар.

Съев 1 банку сгущенного молока, вы наберёте мгновенно 1150 калорий, что не рекомендуются для похудения. Диетологи не рекомендуют, есть сгущенку как отдельное лакомство. Правильнее будет добавить 1-2 ложки сгущенного молока вместо сахара.

Для изготовления диетической сгущенки в бытовых обстоятельствах понадобится:

Всё нужно перемешать и варить около 2 часов. Дать остынуть, а затем поставить в холодильник для загустения. Такая сгущенка меньше калорийна, но она не так полезна, равно как натуральная.

Полезно знать

Сегодня можно встретить большой выбор этого лакомства. Но как правильно купить не только аппетитный, но и хороший, высококачественный продукт? Исследовав сгущенное молоко, Роспотребнадзор установил, что 85 % товаров — подделка. Оказывается, можно сделать этот молочный продукт и без нужных ингредиентов — молока и сахара!

Цельное молоко включает хороший легкоусвояемый жир, что придает вкус и запах. В состав подделки входит пальмовый растительный жир. Он почти не растворяется, а оседает на стенках внутренних органов, при этом нарушает работу ЖКТ, поэтому очень опасен для любого организма. Зачем его добавляют?

Это выгодно: сгущенка на базе пальмового жира обходится в 2 раз дешевле, чем на базе молока.

Молоко — сезонный продукт, которого зимой меньше. Чтобы производство постоянно приносило прибыль, должны быть под рукой необходимые ингредиенты всегда.

Сгущенка — любимое лакомство многих людей, причем не зависимо от возрастной категории. Это самодостаточный десерт либо вкусная добавка к бодрящим утренним напиткам. Так же это традиционный ингредиент для эстетического и вкусового украшения тортов и пирожных.

Упаковка

Привычным видом фасовки считается жестяная банка, но в последнее время прилавки магазинов пестрят разнообразием пластиковых упаковок, стеклянных банок и туб со сладостью.

Исторические данные

Вопреки бытующему мнению, сгущенное молоко — это не продукт советской промышленности. По непроверенным данным, этот десерт придумал французский кондитер Аппер в первой половине 19 века, по заказу Наполеона. Французы сдержанно отнеслись к десерту в отличие от англичан. Этот метод консервации молока запатентовал Питер Дюрант, так же к его идее можно отнести использование жестяных банок. Официально время открытия этого продукта приходится на 1810 год, и лишь через четверть века пришла мысль обогатить вкус вязкой кремовой жидкости сахаром (1826 год).

Гейл Борден, истинный бизнесмен, воспользовался навыками и трудами первооткрывателей и доработал метод. Предприниматель отличался неудержимой жаждой к открытиям. Молоко пробудило интерес к себе малым сроком годности. Создав вакуумную установку, он стал выпаривать излишнюю влагу из продукта, увеличивая концентрацию. На выходе получился густой, вязкий продукт, а, включив в состав сахар — «Сгущенное молоко». Доработанный продукт официально зарегистрирован был в 1856 году. Гениальное решение готовить молоко таким образом пришло «капиталистам». Производить сладость стали в штате Нью-Йорк.

Развитию, рекламе и продвижению поспособствовал массовый заказ для потребностей армии в период Гражданской войны 1861 года в Америке. Позже, рекламный трюк с этикетками, на которых изображены счастливые дети, поглощающие продукт, координировал направленность на рынок детского питания.

Так же существует версия, что сгущенное молоко появилось 5000 лет назад и первыми ее стали готовить в Индии. В России же свою жизнедеятельность продукт начал в 1881 году. Настоящий нефальсифицированный продукт — это не просто сладкая субстанция. В сущности, это коровье молоко с выпаренными излишками влаги и продленным сроком пригодности.

Традиционный состав сгущенного молока

  • Белки.
  • Жиры.
  • Углеводы.
  • Ди-моносахариды.
  • Холестерин.
  • Насыщенные жирные кислоты.
  • Органические кислоты.
  • Холин.
  • Витамины группы В (В1, В2, В5, В6, В12).
  • Аскорбиновая кислота.
  • Витамин РР.
  • Витамины А, Е, D.
  • Витамин H.
  • Минералы (Se, Co, F, Ca, Mg, Na, K, Cu, Zn, Mn, I, Fe).

Полезные свойства продукта

  1. Легкая усвояемость. Выигрывает в сравнении с цельным молоком.
  2. Высокая питательная ценность. В результате приготовления не теряются биологически активные вещества.
  3. Моделирующая особенность. Ускоряет строительные процессы и рост мышечной ткани. Способствует созданию красивых рельефов.
  4. Активный рост мышечной массы. Ценное питание для бодибилдеров.
  5. Отмечено положительное влияние на структуру костной ткани за счет высокого содержания кальция.
  6. Кроветворная функция. Нормализует структуру крови.
  7. Стимулирующая умственную активность сладость.
  8. Отмечено иммуномодулирующее свойство — кладезь витаминов и микро-макроэлементов, способствующих образованию защитных барьерных функций организма.
  9. Питательная. Высококалорийный продукт, применяемый в пищу в полевых условиях туристами, солдатами. Во времена советской эпохи все сухие пайки укомплектовывались жестяной банкой молока сгущенного.
  10. Тонизирующее свойство так же присуще этому продукту — улучшается общее состояние организма. Отличный источник позитивного настроения.

Любой пищевой продукт имеет противопоказания, этому могут служить различные причины, в первую очередь они связаны с проблемами здоровья.

Употребляя этот продукт, необходимо соблюдать меру. Диетологами рекомендовано принимать в пищу до трех ложек десерта. В случае чрезмерного потребления можно рассчитывать на приобретение сахарного диабета, разрушения зубов, кариеса, ожирения. Объясняется это большим количеством сахара в составе, а также высокой калорийностью продукта. Полностью следует отказаться от сгущенки диабетикам и людям с холециститом.

Чтобы избежать проблем с пищеварением, отравления, необходимо обращать внимание на целостность упаковки и состав. К сожалению, часто наблюдаются факты фальсификации популярного, доступного и любимого всеми продукта. Статистика утверждает, что больше половины предложенных марок нарушают технологию и выходят за рамки требований ГОСТа.

Маркировка — на что обратить внимание?

  1. Тара должна быть целой без видимых повреждений.
  2. Сроки реализации не должны выходить за рамки заявленной даты на упаковке. Если это пластик, то с момента производства до открытия можно хранить продукт до трех месяцев. В жестяных банках, при условии, что температура хранения не будет превышать +10 градусов, хранят до года. Открыв жестяную банку, содержимое рекомендовано незамедлительно переложить в стеклянную емкость. При покупке товара на розлив в киосках и магазинах, ее хранение ограничивается пятью днями.
  3. На этикетке название продукта должно полностью соответствовать надписи «Молоко цельное сгущенное с сахаром». Другие вариации и перестановки слов не гарантируют соответствия требованиям ГОСТа.
  4. Описание состава на маркировке может рассказать о натуральности продукта и о добавках, не несущих пользы. В перечне составляющих не должно быть жиров растительного происхождения, только натуральный молочный жир.
  5. Недобросовестные производители часто используют диоксид титана Е171 для придания более белого цвета. Его используют для изготовления красок, аккумуляторов и керамических изделий. Это вещество, хоть и добавляется в пределах нормы, — не полезно для организма, а понимание того, что диоксид титана — яд, делает продукт не привлекательным для потребителя.
  6. Один из критериев, подтверждающих качество, является жестяная упаковка. Находясь в поисках натурального ГОСТовского продукта, можно смело проходить мимо пластиковых пакетов и туб.

Как приготовить настоящую сгущенку дома

  1. Классический вариант. Молоко (2 стакана), сахар (полтора стакана) соединяют в эмалированной емкости и нагревают до однородности. Варят до вязкого, густого состояния. Весь процесс сопровождают помешиванием. В чашу блендера вносят молоко (2 стакана), сахар (полтора стакана), взбивают до однородности. Готовят в режиме «тушение» в мультиварке (2 часа). Это рецепт, не требующий присутствия, позволяющий получить привычный вкус. При отсутствии мультиварки, взбитый блендером однородный состав разливают в жаропрочную посуду и томят в духовом шкафу при 160 градусах.
  2. Для ценителей диетического питания. Быстрый вариант (20 ккал на 100 г). Загуститель содержащий клетчатку (камедь ксантановая), подсластитель (стевия), обезжиренное молоко (1 литр). Все ингредиенты смешивают в объемной эмалированной емкости, пробивают погружным блендером. Смесь имеет сходство с суфле, но выигрывает своей калорийностью.
  3. Сгущенка на основе соевого молока. Молоко из сои (1 литр), агар-агар, заменитель сахара, ванильный экстракт, веганский ароматизатор для десертов, соевый протеин (2 ст. ложки). Молоко взбивают блендером, всыпают протеин, агар-агар разводят согласно рекомендациям на упаковке. Все составляющие соединяют, взбивают (12 минут). После того, как составляющие увеличатся в объеме, ставят в холод на несколько часов.
  4. Диетический продукт с привычным вкусом. Молоко (стакан), СОМ (2 ст. ложки), крахмал кукурузный (1 ложка), заменитель сахара. При помощи блендера смешивают все компоненты, готовят в мультиварке 7 минут в режиме «пароварка» либо «тушение», перемешивают, варят еще 7 минут. Готовят интервалами по 7 минут до необходимой консистенции.

Приобретая вкусный и полезный продукт «Молоко цельное сгущенное с сахаром», важно понимать, что натуральный состав не включает в себя ничего кроме молока и сахара. Необходимости в дополнительных составляющих нет.

Видео: в чем польза сгущенки?

Сгущенка во время похудения — диетолог дала добро на любимый вкус детства, но с условием

Наверняка сгущенка ассоциируется у многих с исключительно “нездоровым питанием”. Однако не стоит жестко ограничивать себя или полностью отказываться от любимой сладости. Украинский диетолог и тренер Нина Радзиевская посвятила “теме сгущенки” отдельный пост. И подробно рассказала, как правильно выбрать этот десерт или приготовить его дома, а также сколько его можно в день.

Сгущенка во время похудения

Сгущенка — калорийность и дневная норма 

“Как самый худой и маленький диетолог (вес 43 кг, талия 57 см) авторитетно заявляю — обожаю сгущенное молоко по утрам! И вам советую. Учитывая то, что в состав правильно приготовленной сгущенки входят только коровье молоко и сахар, эта сладость полезнее многих других: конфет, печенек и т.д. Ведь она не содержит всевозможных добавок в виде ароматизаторов, красителей, консервантов”, — отмечает диетолог. 

Калорийность 100 г сгущенного сладкого молока жирностью 8,5 % равна 328 ккал.

Конечно, сто грамм сразу съедать не надо! А 25-50 грамм по утрам всего-то 100-150 калорий — хорошая замена конфетам.

Можно ли сгущенное молоко детям? 

Белки коровьего молока и кальций принесут пользу растущему организму, а не только удовлетворяет потребность ребенка в лакомстве.

Кальций, витамин D, фосфор помогут сформировать прочный костный скелет.

Глюкоза помогает быстрому восстановлению энергетических запасов после длительных заболеваний, спортивных соревнований. Она повысит активность не только физическую, но и интеллектуальную, улучшит эмоциональный настрой ребенка.

Так как в технологическом процессе изготовления сгущенного молока применяется температура, не превышающая 50 С, то практически все полезные свойства, присущие натуральному коровьему молоку, сохраняются.

Таким образом, сгущенное молоко, приготовленное без нарушений технологического процесса, для ребенка гораздо полезнее пирожных, чупа-чупсов, лимонада и шоколадных конфет.

Как выбрать качественную сгущенку?

  1. На упаковке качественного продукта, в соответствии с ГОСТом, должно стоять название «Молоко сгущенное цельное с сахаром». Подделка может иметь разные наименования: «Молоко сгущенное особое», «Молоко сгущенное», «Сгущенка» и др.
  2. На этикетке должно быть указано, что продукт изготовлен по ГОСТу, а не по ТУ.
  3. Жирность обязательно должна быть равной 8,5 %.
  4. В состав продукта должны входить только сахар и натуральное молоко. Растительных масел, включая пальмовое, любых других добавок не должно быть.

Рецепт домашней сгущенки: 

  • В эмалированную кастрюльку выливаем 0,5 л молока и добавляем полтора стакана сахара. 
  • При постоянном помешивании нужно прогреть молоко до тех пор, пока сахар полностью растворится. Смесь следует варить до загустения. 

Для приготовления в духовке: 

  • Смесь взбитого сахара с молоком распределите в горшочки и поставьте в духовку при температуре 160 С. Получится вареная сгущенка.

Анна Саливанчук поделилась опытом похудения и провела эфир с диетологом

Напомним, ранее мы писали, какую опасность таят в себе сахарозаменители.

Сгущенное молоко. Самая полезная сладость

Гастритом называется воспалительный процесс эпигастрия. Выделяют множество причин развития заболевания.Часто встречаются нездоровая пища, вредные привычки, чрезмерные эмоциональные переживания и иные заболевания желудочно-кишечного тракта. Как правило, во время катара происходит патология желудочной секреции, отчего уровень кислотности желудка способен расти или уменьшаться.

Симптоматика гастрита проявляется в острых болях в области живота, приступах тошноты, отрыжке или изжоге. Признаки воспаления проявляются натощак либо после еды. Считается, что большое значение во время заболевания имеет правильная диета. Неприятные ощущения, сопряженные с болезнью, устраняются при помощи лекарственных препаратов, но нормализовать работу желудка способно исключительно здоровое питание.

Перед лечением при помощи диеты полагается проконсультироваться с диетологом для назначения правильного питания. Известны диеты, подходящие для всех заболеваний желудочно-кишечного тракта одинаково, выделяют также избранные случаи.

Если при воспалении желудка не произошло сильных изменений уровня желудочного сока, выписывается универсальная диета. Пациенту нельзя употреблять острую, соленую и жареную пищу, запрещается прием спиртных напитков. Питание происходит дробно: не менее 5 раз в сутки небольшими порциями. Если уровень желудочного сока подвергся изменениям, пациенту не рекомендуется принимать пищу, способную повлиять на кислотность. На основе указанных правил выбирают подходящую и не рекомендуемую пищу.

Разрешена ли сгущенка во время заболевания ЖКТ

Многих любителей сладкого волнует, допустимо ли съесть сгущенку при гастрите, ведь лечение подразумевает особую диету. Редкий пациент в состоянии вытерпеть терапию без любимой сладости.

Диетологи утверждают, что употребление сгущенки при воспалении желудка разрешается. Как известно, её насыщают молочные белки и кальций, что благоприятно воздействует на ЖКТ. полезно, сохраняет собственную пользу и в сгущённом виде.

Злоупотреблять продуктом не стоит, он богат на калории и слишком жирный, способный вызвать расстройства органов пищеварительного тракта. Допускается умеренный прием. Диетологи рекомендуют принимать продукт на завтрак либо обед до трех чайных ложек.

Стоит быть предельно осторожными с продуктами, лишь напоминающими сгущенку, имеющими мало общего с натуральным продуктом. Как правило, для изготовления суррогатов производители пользуются разнообразными пищевыми добавками. Молоко заменяет крахмал, пальмовое или растительное масло и молочный порошок. Подобный продукт способен навредить здоровью, перед покупкой следует внимательно ознакомиться с составом.

Какую сгущенку можно

Выбор сгущенки важен. Не каждая подойдет для восстанавливающегося организма. В первую очередь больному рекомендуется подобрать зарекомендовавшую себя качественными продуктами марку. Следите, чтобы товар соответствовал параметрам, указанным в ГОСТе.

Искусственные добавки неприемлемы. Сгущенное молоко со вкусом клубники или банана однозначно не подходит, в состав добавляют различные компоненты, усиливающие вкус. Диетологи запрещают употреблять при гастрите вареную сгущенку. Она считается чересчур жирной, насыщенной сахаром и иными компонентами, вредными для здоровья в лечебный период.

Польза для организма

Сгущенка приятна на вкус, обладает рядом полезных свойств:

Противопоказания

Как отмечено ранее, наибольшие опасности ожидают покупателя не во время употребления, а при покупке. Сегодня трудно найти на прилавках магазинов качественный товар. Иногда слово «ГОСТ» на упаковке не дает стопроцентной гарантии, что продукт содержит исключительно нужные компоненты. В части случаев состав сгущенного молока навредит и больному с воспалением желудка, и совершенно здоровому человеку.

Пожалуй, самым вредным продуктом для здоровья считается масло, сливочное или растительное. Вредное по причине жирности. Индикатором отказа от покупки сгущёнки станет цвет. Противопоказан продукт бежевого или коричневого цвета, говорящий о содержании жиров в составе. Принимать в пищу разрешено лишь белую сгущёнку.

Вареная сгущенка считается вредной из-за добавок. Наполнители изменяют вкус продукта, повышают кислотность, отрицательно влияя на работу внутренних органов.

Качественный продукт станет полезным во время лечения воспаленного желудка, но потреблять его требуется немного. Злоупотребление сахаром навредит больному человеку и здоровому.

Иные сладости при воспалении

Больных интересует разрешение и на другие сладости. Отнюдь не все продукты полезны для человека во время воспаления.

Шоколад

Диетологи не советуют есть шоколад при воспалении слизистой оболочки желудка. Продукт насыщен жирами, его трудно переваривать, что станет причиной расстройства органов пищеварения и боли в подложечной области. Вредность шоколада для организма заключается в присутствии в составе вкусовых компонентов, орехов с изюмом, запрещённых при патологии желудка.

Допускаются исключения. Диетологи утверждают, что вполне безопасен для здоровья черный шоколад, но не стоит злоупотреблять. Рекомендуется принимать до 40 граммов в день. Остальные виды шоколада навредят организму. Нежелательно употреблять шоколадные конфеты при гастрите.

Мороженое

Согласно заявлениям диетологов, мороженое благоприятно влияет на терапию катара, если уровень кислотности повышен. Мороженое провоцирует уменьшение кислотности и нейтрализует неприятные ощущения в желудке. При покупке стоит оставаться внимательным. Нужно изучать состав продукта, нежелательно содержание ароматизаторов и сахарозаменителей.

Если у больного диагностировали гастрит с пониженной кислотностью, мороженое противопоказано.

Сухофрукты

Запрещается употребление кураги, изюма, чернослива и инжира при расстройстве желудка. Причина в том, что перечисленные продукты обладают слишком толстой шкуркой, надолго остающейся в желудке, затрудняя лечение заболевания.

Остальные сухофрукты разрешено употреблять. Врачи отмечают, что благоприятнее для человека компоты из сухофруктов.

Варенье

Во время гастрита варенье считается разрешенным продуктом к употреблению, но злоупотреблять не стоит. Важно учитывать то, повышена или понижена кислотность желудка. К примеру, кислый продукт при низком уровне кислотности полезен, но при высоком вызовет больше неприятных ощущений.

Если соблюдать правила, сгущенка при гастрите и прочие сладости допускаются. Важно употреблять продукты правильно, при любых осложнениях советоваться с лечащим врачом.

Сгущенка — удивительное лакомство, непревзойденный вкус которого знаком многим россиянам с раннего детства. Маленькие детки готовы кушать ее целыми ложками. Впрочем, как и некоторые взрослые. Но, оказывается, так делать нельзя. Ведь как и любая другая сладость, имеет свои как полезные свойства, так и противопоказания. Диетологи рекомендуют его употреблять в количестве до 2 ст. ложек в сутки, не больше. По их словам, чрезмерное поедание лакомства может причинить серьезный вред организму. Но обо всем по порядку.

Немного из истории

Прежде чем говорить о вреде и пользе сгущенного молока, позвольте рассказать чуть-чуть об истории его происхождения. Принято считать, что лакомство это было придумано в СССР во времена дефицита различных продуктов. Однако это неверно! Рецепт на самом деле появился еще в начала 19 века. Его создателем стал француз Аппер. Однако запатентовать свое изобретение ему не удалось. Зато это получилось у Питера Дюранта. Кстати, именно этому человеку также принадлежит идея использования для хранения лакомства специальных жестяных банок.

Однако в те времена сгущенное молоко все еще не имело привычного аромата и вкуса. Их оно приобрело в 1826 году, благодаря хитроумному предпринимателю Гейлу Бордену. Именно его работники на заводе стали впервые создавать сгущенку путем выпаривания с тростниковым сахаром. Впрочем, некоторые ученые оспаривают подобные сведения. Они утверждают, что право на изобретение продукта принадлежит жителям Индии. Якобы они знали, как его создавать, еще 5000 лет тому назад.

В России сгущенка появилась спустя почти 60 (5000?!) лет после изобретения. Случилось это в 1881 году. Постепенно она настолько полюбилась нашим соотечественникам, что те позаимствовали рецепт и стали по нему готовить. Причем не только на заводах, но и в домашних условиях. И вот результат — сегодня многие уверены, что это удивительное лакомство было изобретено русскими. Но… увы и ах!

Хорошая сгущенка — какая она?

Есть один момент, который хотелось бы уточнить, прежде чем рассказывать о вреде и пользе сгущенного молока для организма. Звучит он так: сгущенка на рынке сегодня представлена разная, да вот только не вся она целебна. Хитроумные производители наловчились добавлять в состав разные растительные жиры и загустители. При этом они на этикетке ставят обозначение ТУ. Так вот, мимо такого продукта лучше проходить, он никак не может называться полезным. Поскольку в состав сгущенки не должно входить ничего, кроме сахара и молока. И иногда еще — кофе, какао или сливок.

Чтобы не ошибиться с выбором, можно обращать внимание на этикетку, наклеенную на жестяную или мягкую упаковку. На ней должно быть четко указано, что качество сгущенки соответствует ГОСТ 2903-78 — для России, либо для Украины — ДСТУ 4274:2003. А также написано, что это «Молоко цельное сгущенное с сахаром». Никак иначе продукт называться не может. И еще один такой момент: не забывайте смотреть на дату изготовления, лакомство не должно быть просроченным. Если дома вы заметили, что на его поверхности имеются пузырьки или пенка непонятного цвета, выбросьте. Здоровье дороже всяческих денег!

Польза сгущенного молока с сахаром

Если вам удалось заполучить качественный продукт, знайте: вы не прогадали. Он гораздо полезнее любых других лакомств, таких как: мармеладки, шоколадки, йогурты и так далее. Поскольку в его состав входит большое количество полезных веществ, среди которых можно отметить особо:

  • кальций — способствует укреплению костной структуры и зубов;
  • витамин D — помогает дольше не стареть, укрепляет кости;
  • калий и магний — нормализуют работу сердца и сосудов;
  • фосфор — необходим для хорошего кровообращения;
  • витамин C — позволяет укрепить иммунитет;
  • глюкоза — способствует восстановлению сил;
  • и так далее.

Кроме того, сгущенку рекомендуется употреблять для нормализации гормонального фона, увеличения лактации (кормящей маме!), восполнения запаса минералов и витаминов, улучшения общего самочувствия, улучшения зрения, активного набора мышечной массы (полезно для бодибилдеров!)

Правила употребления

Говорить о пользе сгущенного молока можно лишь в том случае, если вы будете его правильно употреблять. Чрезмерное поедание лакомства, как и любых других сладостей, ни до чего хорошо довести не может. Поэтому диетологи и врачи рекомендуют воздержаться от этого. Как уже говорилось выше, разрешенное количество — не более 2 ст. ложек в сутки для взрослых и 2 чайных для маленьких детей старше 2-3 лет. Лучше всего добавлять в чай, кофе или просто в водичку (для малыша!). Либо сочетать с какими-либо фруктами (например, бананами или киви). Мазать на батон можно, но при этом важно стараться не превышать дозировку.

Правила хранения

Пользы от сгущенного молока будет тем меньше, чем дольше оно будет храниться. А если это делать неправильно, польза сведется на нет. Производители рекомендуют сразу после покупки убирать лакомство в холодильник. После открытия его можно хранить не дольше 12 месяцев, при температуре от 0 до +10 градусов, если оно находится в жестяной банке. В мягкой упаковке его нельзя хранить более 3 месяцев. При покупке сгущенки на розлив срок ее употребления ограничивается пятью месяцами. Если, открыв продукт, вы увидите в нем комочки, кристаллики или плесень, его необходимо немедленно выбросить. Поедание испортившегося лакомства очень вредно для вашего здоровья.

Вред сгущенки для здоровья человека

Недостаток сгущенного молока в том, что при изготовлении в него добавляют много сахара. Конечный продукт получается высококалорийным и жирным. Поэтому в больших количествах его потреблять запрещено, особенно малым деткам. Кроме того, от лакомства желательно отказаться людям, страдающим от избыточного веса, сахарного диабета, аллергии на молоко или сахар. А также тем, кто заботится о здоровье своих зубов и стройности фигуры. Поскольку чрезмерное употребление сладкого может привести к развитию кариеса и патологическому ожирению.

Польза и вред кофе со сгущенным молоком

Отдельного внимания заслуживает употребление кофе со сгущенкой. С одной стороны, такой напиток весьма полезен, так как в нем содержится, кроме витаминов с минералами, 30 органических кислот. Благодаря этому лакомство способно оказывать стимулирующее, нормализующее, успокаивающее действие на организм. Ежедневное питье позволяет избавиться от депрессии и плохого настроения, улучшает самочувствие.

С другой, кофе со сгущенным молоком способен привести к повышению холестерина в крови, головокружениям, бессоннице и головной боли. Впрочем, чтобы всего этого не провоцировать, достаточно употреблять не более 2 чашек напитка ежедневно. С осторожностью следует пить лакомство людям, страдающим от заболеваний почек, ишемической болезни сердца, гипертонии, атеросклероза или глаукомы. А также детям до 14-16 лет и беременным женщинам.

Видео от специалистов: о пользе сгущенки

Рецепт домашней сгущенки

Сгущенное молоко будет максимально полезным, если вы сделаете его дома, своими руками. Это не так сложно, как может показаться. Нужно лишь запастись литром свежего домашнего молока и стаканом сахара (можно заменить сахарной пудрой). Из посуды понадобится кастрюля из нержавейки и ложка (лучше деревянная!) Когда все будет подготовлено, можно перейти к приготовлению лакомства. Последовательность действий такова:

  1. Налить молоко в кастрюлю и поставить на медленный огонь.
  2. Вскипятить его. Сразу отлить из посуды около 1 ст. жидкости.
  3. В стакане с горячим молоком растворить весь имеющийся сахар, перемешать.
  4. Вылить смесь обратно в кастрюлю, продолжить варить на маленьком огне.
  5. В течение всей варки помешивать будущее лакомство, чтобы не подгорело.
  6. Как только от его первоначального объема останется 1/3 (именно столько, это важно!), а само оно приобретет слегка кремовый оттенок, сгущенное молоко перелить в стеклянную банку.
  7. Чуть остудить и убрать в холодильник на верхнюю полку на ночь.
  8. К утру сгущенка уже будет достаточно вязкой, ее можно кушать.

Обратите внимание! Варить молоко с сахаром следует не дольше 35-40 минут. Очень важно не передержать его, иначе вместо сгущенки вы получите карамель. При этом выпарить не полностью тоже нельзя, иначе жидкость не сможет приобрести нужную вязкость. Поэтому следите внимательно, что у вас творится в кастрюле.

В качестве заключения!

Теперь вы знаете все об истории, правиле выбора, пользе и вреде сгущенного молока с сахаром. А также о том, как его можно приготовить в домашних условиях. Желаем вам приятного чаепития, не болейте!

Из-за популярности товара польза и вред сгущенки являются важным вопросом для покупателя. В данной статье рассматривается все, что касается сгущенного молока: свойства, особенности употребления, польза, вред, противопоказания.

Что такое сгущенка

Сгущенка – полезный продукт питания, состоящий из смеси молока и сахара. Делается сгущенка путем выпаривания или концентрирования молока. В состав жидкости также добавляют 11% сахара, за счет чего она достигает однородной консистенции. По цвету бывает белая и коричневая.

Состав и калорийность сгущенки

Польза и вред сгущенки для здоровья обусловлены ее химическим составом. По ГОСТ в сгущенку должны входить молочные жиры – 8,6%.

Витамины класса B и витамины A, D, PP, C, E, H.

Полезные минеральные вещества:

  • железо;
  • магний;
  • сера;
  • фосфор;
  • калий;
  • кальций;
  • селен.

В стандартной банке 1220 ккал (330 ккал на 100 граммов).

Полезные свойства сгущенки

Полезные свойства сгущенки объясняются огромным количеством минералов и витаминов. Если есть ее каждый день в малых количествах (100 граммов), иммунитет организма укрепится уже через несколько дней.

Польза сгущенного молока в умеренном количестве не преувеличена, а вот если съедать целыми банками, то только во вред себе.

Важно! Сгущенка хорошо восстанавливает организм после долгих физических или умственных нагрузок.

Калий положительно влияет на работу сердечно-сосудистой системы, а хлор избавляет от отеков.

Сгущенка полезна, почти так же, как и молоко, зато, если ее сварить, она намного быстрее усваивается организмом. Для зрения, зубов и костных тканей она тоже принесет пользу.

Можно ли сгущенку беременным и кормящим женщинам

Диетологи во время беременности запрещают есть много сладостей, и сгущенка не исключение. Поэтому 100 граммов в день более чем достаточно. Она может обеспечить организм полезными минералами и витаминами, а также укрепить иммунитет.

Во время кормления за один день больше двух чайных ложек сгущенки есть вредно. Ведь все, что ест мать, попадает с молоком в организм ребенка. При проблемах с желудком у ребенка матери лакомство противопоказано, так как оно может вызывать газообразование и причинить малышу вред.

Польза от его употребления есть, но основной причиной ограничения в обоих случаях является содержание в большой концентрации сахарозы. Так что полезным молочный десерт будет только в малых количествах.

При сахарном диабете про сгущенку лучше забыть.

Замечание! В одной банке сгущенки 1220 ккал. Во время кормления грудью она приводит к набору веса матери и негативно сказывается на здоровье ребенка.

С какого возраста сгущенку можно давать детям

По сравнению с конфетами и шоколадками, которые приносят только вред, эта сладость полезнее по причине отсутствия в ней красителей и усилителей вкуса. Ребенку употреблять ее можно с 3–4 лет. Но только в малых порциях: не более 100 граммов в день. Если больше, то это уже не польза, а вред, из-за которого ребенку в будущем будут обеспечены кариес, сахарный диабет и ожирение. А вот концентрированное молоко детям никакой пользы не принесет.

Сгущенка при гастрите и панкреатите

Разрешение есть сладости при гастрите зависит от стадии развития. На последней стадии есть сгущенку нельзя из-за ее жирности.

При любой другой стадии ее употребление разрешено, и польза для организма будет, только если есть ограниченными порциями.

При панкреатите тоже следует различать периоды обострения и ремиссии. Так как во время обострения панкреатита поджелудочная железа уязвима и требует покоя и исключения нагрузок, употреблять сгущенку в это время вредно.

В период устойчивой ремиссии панкреатита следует ограничивать жиры и углеводы, поэтому есть сгущенное молоко тоже вредно.

Если очень хочется, 100 граммов сгущенки съесть можно, но лучше не стоит.

Самой распространенной причиной запрета этого продукта во время болезней и не только являются не столько калорийные свойства и высокая концентрация сахара, сколько способ изготовления товара производителями. В случае выбора подделки сгущенное молоко может принести не пользу, а вред для здоровья организма.

Сгущенное молоко при подагре есть можно и нужно, потому что оно относится к ощелачивающим продуктам и его наличие в рационе обязательно. Поэтому польза от свойств этого лакомства очевидна.

Сгущенка при похудении

Важно! Калорийные свойства сгущенки совершенно не подходят людям, которые сидят на диете или следят за здоровым питанием.

Данный продукт во время похудения употреблять можно, но только в строго ограниченных порциях. При здоровом питании или диете употреблять больше 2 чайных ложек в день не позволительно. Одной банки достаточно, чтобы вмиг набрать 1220 калорий. Лучше добавлять лакомство в чай, кофе или какао вместо сахара.

Как приготовить сгущенку в домашних условиях

Быстро приготовить сгущенку сможет каждый. На весь процесс потребуется всего 15 минут. Несмотря на быстроту готовки, все свойства соответствуют магазинным. Также она дешевле и натуральнее обычной, а пользы от сгущенного молока с сахаром по домашнему рецепту больше. Чтобы все получилось правильно, необходимо следовать инструкции.

В итоге получится порция в 520 мл.

Ингредиенты:

  • 400 г сахарной пудры;
  • 40 г масла;
  • 400 г молока.

Приготовление:

  1. Смешать все ингредиенты и поместить их в кастрюлю.
  2. Включить слабый огонь и мешать жидкость до полного растворения ингредиентов.
  3. Когда жидкость начнет закипать и появится пенка, необходимо прибавить огня и, мешая, варить смесь. Она будет пениться, и, если начнет убегать из кастрюли, надо сделать огонь поменьше.
  4. С момента, когда смесь начала кипеть, варить 11 минут.
  5. После этого охладить кастрюлю в воде до теплой температуры.
  6. Когда однородная масса станет теплой, перелить ее в банку и закрыть. После охлаждения она станет густой и примет привычный вид.

Какая сгущенка полезнее: обычная или вареная

Вареная сгущенка обладает почти такими же свойствами, как и обычная. Но некоторая часть минералов и витаминов теряется при варении.

Основным отличием вареной сгущенки от обычной является высокая питательность и легкость усвоения всех полезных элементов организмом.

В вареном сгущенном молоке находится огромное количество кальция, очень полезного для зубов и костей.

Важно! Полезных веществ в лакомстве так много, что они способны улучшить обмен веществ организма, работоспособность головного мозга, повысить иммунитет, наполнить организм витаминами и полезными веществами.

С чем едят сгущенное молоко

Для комбинирования можно использовать выпечку, а также чай и другие горячие напитки. Любой полезный мучной или злаковый продукт можно сочетать со сгущенным молоком.

Его также добавляют в торты, пирожные, мороженое. Очень вкусным получается торт «Муравейник» со сгущенкой. По утрам можно есть манную кашу со сгущенным молоком.

Вред сгущенки и противопоказания

В сгущенке очень большая концентрация сахара, за счет чего она калорийная и вредная в больших количествах.

Противопоказания:

  • полнота;
  • панкреатит почти на всех стадиях развития;
  • гастрит в последней стадии;
  • сахарный диабет.

Фальсификат может принести только вред. В таких продуктах содержится краситель E171 – едкое вещество, вредные жиры, растительное масло и пищевые добавки, которые ухудшают свойства сгущенки и сильно вредят организму. Поэтому при выборе товара нужно внимательно смотреть на наличие надписи ГОСТ на банке и на состав продукта. Если в нем есть что-то, кроме нормализованного молока и сахарозы, это подделка.

Как выбирать и хранить сгущенку

Для правильного выбора сгущенного молока нужно знать определенные критерии и свойства, по которым можно найти настоящий продукт.

Признаки качественного продукта:

  • Название на этикетке: «Молоко цельное сгущенное с сахаром».
  • Регламент ГОСТа 2903-78 и ГОСТ Р53436-2009.
  • Выбор производителя: чем крупнее и авторитетнее производитель, тем лучше.
  • Состав и свойства: кроме сахара и молока ничего быть не должно, если есть, то это подделка, от которой будет только вред.
  • Металлическая банка в синей обертке. Битые или изогнутые банки лучше не брать.
  • После вскрытия банки нужно обратить внимание на свойства: наличие комков сахара – это подсластитель; неестественный цвет означает наличие вредных компонентов.
  • Если сгущенка выглядит неоднородно, молока в ней мало.
  • Не забывать про срок годности.

Хранить сгущенку можно несколько месяцев в сухом месте. Для долгого хранения больше подойдет холодильник. Там она простоит целый год.

Заключение

Благодаря ценным свойствам польза и вред сгущенки неравнозначны. Продукт богат полезными веществами, поэтому рекомендован для здорового питания. Но калорийность ограничивает употребление лакомства до 100 граммов в день. При наличии заболеваний ЖКТ и ожирения молочный десерт лучше исключить из рациона: пользы он принесет мало, а вот вред причинить может существенный.

Была ли Вам данная статья полезной?

Сгущенное молоко – это сладкий, вкусный и любимый всеми детьми продукт. Состав сгущенного молока довольно прост — сахар и коровье молоко. В последнее время сгущенное молоко стали продавать в разнообразной таре: в жестяных 400-граммовых банках, в пластиковых и стеклянных банках, в тубах и жестких пакетах.

Калорийность сгущенного молока очень высока – 320 ккал на 100 г продукта. При этом в сгущенке содержится 34% белка.

Сгущенное молоко употребляют в пищу как самостоятельный сладкий продукт, а также добавляют в выпечку, чай и .

Польза сгущенного молока

Сгущенка обладает всеми полезными качествами коровьего молока. Если она сделана качественно, организм полностью усваивает ее и обогащается содержащимися в ней полезными веществами.

Кальций способствует укреплению костей, ногтей и зубов, улучшает зрение. Помимо кальция в сгущенке содержатся соли фосфора, которые отвечают за деятельность мозга и восстановление крови.

Вред сгущенного молока

Употребляя сгущенку важно помнить о чувстве меры. Употребление больше 3 ложек в день может привести к развитию ожирения, сахарному диабету и кариесу.

Польза и вред сгущенного молока напрямую зависят от состава этого продукта. Как же не ошибиться и выбрать приятное лакомство, а не опасную подделку? Прежде всего, стоит обратить внимание на название. «Цельное сгущенное молоко с сахаром» — такое название у сгущенки согласно ГОСТа. Жирность сгущенки не должна быть ниже 8.5%. В составе сгущенного молока допустимы только коровьи жиры. Стоит остерегаться, если в состав сгущенки входит — такой продукт точно не поспособствует вашему здоровью. Если при открытии сгущенки была обнаружена неоднородность структуры – комочки, ее лучше выкинуть, она может быть слишком опасна для здоровья.

Бытует мнение, что сгущённое молоко помогает наладить лактацию. Но есть и противники употребления этого вкусного продукта кормящими мамами. Попробуем разобраться, полезна или вредна сгущёнка при грудном вскармливании.

Польза и вред сгущёнки при грудном вскармливании

Лет 25 назад в роддомах настойчиво советовали для улучшения лактации пить чай со сгущёнкой. Наши мамы, да и многие врачи и сейчас считают, что молочное лакомство обязательно должно входить в рацион кормящих женщин. Прежде чем узнать, насколько это мнение соответствует истине, нужно иметь представление, что же такое нам продают с этикетками, на которых написано «Сгущённое молоко».

Настоящая сгущёнка — средней густоты продукт белого или кремового цвета

Помимо основного компонента коровьего молока сгущёнка содержит сахар. По технологическим условиям (ТУ) некоторые производители добавляют в небольшом количестве натрий и калий для стабилизации, а также немного аскорбиновой кислоты, чтобы избежать окисления.

Натуральный продукт имеет однородную консистенцию белого цвета, иногда с кремовым оттенком. Красители и консерванты не входят в рецептуру настоящего сгущённого молока. Отличить низкокачественную продукцию от натуральной сгущёнки очень просто — слишком густая либо излишне жидкая однозначно имеет нежелательные добавки.

Большинство доводов, почему нельзя сгущёнку кормящей маме, основаны как раз на обилии поддельной продукции в наших магазинах.

Видео: как получается сгущённое молоко и можно ли сделать его в домашних условиях

Повышенное содержание сахара и молочного жира в сгущёнке является главной причиной запрета диетологами бесконтрольно употреблять это лакомство. Несмотря на то что сгущённое молоко по составу менее вредно чем большинство пирожных или конфет, взрослому человеку даже с крепким здоровьем нельзя есть больше двух столовых ложек (около 40 грамм) в день.

У грудничков аллергия проявляется красными зудящими высыпаниями на коже

Таблица: аргументы за и против употребления сгущённого молока при лактации

Влияние на лактацию молока, сгущённого с сахаром, которое добавляют в чай, сильно преувеличено. На жирность и питательность материнского молока влияют абсолютно все продукты, входящие в рацион кормящей женщины. А объём увеличивается из-за горячих напитков, вызывающих усиленную работу молочных желёз.

Но неоспорим тот факт, что во время кормления грудью при желании съесть что-нибудь сладкое лучше всего заменить конфеты и другие кондитерские изделия чайной ложечкой относительно безопасной сгущёнки. Главное, не превышать разрешённые 40 грамм в сутки (2 столовые ложки).

Видео: мифы о грудном вскармливании

Употребление сгущёнки в первый месяц после родов

Пить чай со сгущёнкой в первый месяц современные консультанты по грудному вскармливанию не советуют. Организм новорождённого ещё только начинает приспосабливаться к питанию молоком и следы сахара и лактозы в материнском молоке способны привести к опасному сбою в работе пищеварительной системы крохи.

Специалисты советуют введение сгущённого молока при лактации в свой рацион не ранее второго, а лучше с третьего месяца после рождения ребёнка. В этот период работа кишечника младенца налаживается и пищеварительная система готова к новым блюдам материнского меню.

Чтобы сгущёнка во время кормления грудью не вызвала у малыша проблем со здоровьем, соблюдайте рекомендации при введении этого продукта в рацион:

  • прежде чем пробовать сгущённое молоко, кормящие матери обязательно должны быть уверены в нормальном восприятии детским организмом коровьего молока, как компонента маминого рациона;
  • начинать есть сгущёнку нужно понемногу. В первый раз можно попробовать лакомство на кончике чайной ложечки и затем в течение 2–3 суток наблюдать за состоянием детской кожи и характером стула младенца;
  • специалисты рекомендуют употреблять сгущёнку при грудном вскармливании в утреннее время. Так удобнее отследить возможный негативный ответ со стороны малыша и быстро принять меры при сильной аллергии;
  • при наблюдении негативных реакций лучше прекратить есть сладости при кормлении грудью. Повторно пытаться разнообразить свой рацион сгущённым молоком маме можно через 1,5–2 месяца.

Как кормящей маме выбрать полезную сгущёнку

При выборе молочного лакомства во время грудного вскармливания придерживайтесь следующих рекомендаций:

  • обращайте внимание на стоимость продукта. Акционная или просто низкая цена говорит о низком качестве товара. Он либо длительное время провёл на полках магазина, либо качество изначально невысокое. Такая сгущёнка обычно содержит ингредиенты, не входящие в оригинальную рецептуру, — консерванты, пальмовое масло и ароматизаторы;
  • следите за сроком годности. Просроченный товар не такая уж редкость в наших торговых сетях, но и от продуктов, срок годности которых вот-вот истечёт, лучше отказаться. Такое сгущённое молоко практически испортилось, если не содержит консервантов, а оно не должно иметь их в своём составе. Если товар долго не раскупается, это заставляет задуматься о его вкусе и пищевой ценности. Хорошие продукты на полках не залёживаются;
  • покупайте сгущёнку, изготовленную исключительно по стандарту ГОСТ (Р 53436–2009). Производители, использующие строгую рецептуру, не подмешивают в свою продукцию подсластители и стабилизаторы. Кроме натурального коровьего молока и сахарного песка не должно быть других ингредиентов, тогда сгущёнка будет полезной, а возможный вред значительно снижен.

ГОСТ на этикетке должен содержать серийный номер стандартизации — Р 53436–2009 (российский) или 31688–2012 (международный)

От себя хотелось бы добавить — я очень люблю сгущёнку и уже много лет верна одному производителю. Когда по каким-нибудь причинам не нахожу знакомую продукцию, то выбираю похожую. Во-первых, не покупаю в пластиковой таре, как-то привыкла, что настоящее сгущённое молоко продаётся в жестяных банках. Во-вторых, слежу чтобы стандарт качества товара не являлся просто элементом декора упаковки. Не раз замечала огромными буквами ГОСТ на лицевой стороне ёмкости, и ТУ на обратной стороне. Даже если по ТУ добавлены вполне безобидные ингредиенты, недобросовестный производитель может запросто умолчать о других добавках, а последствия этой халатности отразятся на здоровье потребителя. И ещё, новый продукт я обязательно проверяю дома. Просто варю в баночке на медленном огне в течение двух часов. Если варёнка получается вязкой и однородной, то в следующий раз беру эту сгущёнку без опаски, обращая внимание только на срок годности. А расслоившийся продукт запоминаю и впредь обхожу стороной. Попадалась и ни капельки не изменившаяся за два часа варки, но она была куплена не мной, и по составу я предполагала примерный результат. Мне кажется, сгущённое молоко должно быть вкусным и полезным, особенно в меню кормящих мам, где нет места некачественным продуктам.

Да, на упаковке настоящего лакомства, знакомого с детства, не допускается никаких названий, кроме «Обезжиренное молоко сгущённое с сахаром», «Цельное молоко сгущённое с сахаром» либо «Сгущённые сливки». Разрешены уточнения «с кофе», «с какао», «с цикорием» или «варёное». Остальные варианты к натуральному продукту не относятся.

Видео: как выбирать настоящую сгущёнку

Можно ли кормящим мамам есть варёное молоко и с добавлением какао или кофе

Многие мамочки интересуются, как быть с варёной сгущёнкой, можно ли её во время лактации. Обычное выпаривание молока с сахаром происходит при 60 °C, а варится оно при температуре, близкой к кипению. Высокие температуры убивают полезные свойства любого продукта, и сгущёнка не исключение.

Есть варёное сгущённое молоко, разумеется, можно, но не раньше полугода после родов. К этому времени детская пищеварительная система готова адекватно воспринимать коровий белок, концентрация которого при термообработке возрастает. А при соблюдении норм употребления вероятность аллергии или проблем с кишечником существенно снижается.

Молоко с добавлением кофе разрешено в малых дозах на четвёртом месяце грудного вскармливания. Не то чтобы оно полезно, но мамам, которые любят кофейный вкус, а диета запрещает употребление кофеина, легче будет переносить запрет. Ведь в баночке содержится мизерный процент кофе, неспособный оказать отрицательное влияние на лактацию и общее самочувствие кормящей женщины.

С пятого месяца кормления грудью можно иногда баловать себя молоком сгущённым с натуральным какао. До четырёх месяцев какао входит в список нежелательных продуктов материнского рациона из-за аллергенности, но и после следует употреблять его с осторожностью.

Любительницам кофе придётся по вкусу сгущённое молоко с ярко выраженным кофейным вкусом, но менее вредное, чем оригинальный напиток Сладкая масса, которую можно в небольшом количестве разводить с кипятком, и употреблять, как напиток с пятого месяца после родов

Мнение Комаровского о сгущённом молоке при кормлении грудью

Известный педиатр Евгений Комаровский пользуется авторитетом у коллег и молодых родителей, охотно прислушивающихся к его мнению. В своих статьях и телепередачах Евгений Олегович уделяет немалое внимание грудному вскармливанию и питанию мам в это время.

Доктор Комаровский считает, что добавление сгущёнки в слабозаваренный чёрный или зелёный чай не принесёт вреда матери и ребёнку. Главное, вводить это сладкое лакомство постепенно и следить за реакцией малыша на новый компонент маминого молока. И, естественно, не превышать установленную норму, которая к 5 месяцам составляет 70 грамм в сутки, но ни в коем случае нельзя съедать весь разрешённый объём за один приём. Желательно не есть чистый продукт, а разводить чаем или просто горячей водой.

Видео: Евгений Комаровский о питании кормящей женщины

Особенности употребления молока при похудении

Молоко – это самый первый продукт, с которым знакомится человек после своего появления на свет. Но когда он взрослеет и у него появляется лишний вес, от которого он хочет избавиться, возникает вопрос об употреблении молока при похудении. В этом вопросе нужно учесть сразу несколько нюансов, о которых речь пойдет дальше.

Можно ли употреблять при снижении веса?

Во время любой диеты следует помнить не только о том, что вредные продукты стоит исключить из своего рациона, но и о том, что для организма важно поддерживать оптимальный баланс микроэлементов и витаминов. А в молоке как раз содержится большое количество витамина D, кальция и белка животного происхождения. Это означает, что при похудении его исключать не стоит.

Другой вопрос – это жирность молока. Сейчас на прилавках магазинов можно встретить огромное количество молочных продуктов, на которых красуется надпись «обезжиренное». СМИ и интернет активно продвигают идею того, что чем ниже процент жирности продукта, тем лучше для организма. Но так ли это на самом деле?

Современные американские и европейские исследования говорят обратное. Люди, которые пили жирное фермерское молоко, гораздо быстрее сбрасывали вес по сравнению с теми, кто пил обезжиренный вариант. Но на диете стоит учитывать общую калорийность молочных продуктов, чтобы сбросить вес, а не набрать его.

Вечером желательно сделать отказ от молочной продукции с сахаром. Таким образом вы сможете не поправиться.

Состав

Молоко – это настоящий кладезь полезных веществ для человеческого организма. Оно имеет достаточно низкую калорийность и особо ценится как источник кальция, содержит в себе белок казеин. Он помогает в сохранении мышц при активном снижении веса.

Важные компоненты молока.

  • Кисломолочные бактерии и кислота. Их содержание зависит от способа обработки молока и срока его хранения. Они помогают поддерживать в норме работу кишечника. Кисломолочные бактерии благотворно влияют на его микрофлору, а она, в свою очередь, способствует снижению веса.
  • Молочный белок. При оптимальном количестве помогает сохранить хороший уровень метаболизма, ускоряет жиросжигание и помогает выстроить мышечный рельеф.
  • Кальций. Самый главный компонент для построения костной ткани. Недостаток в организме кальция ведет к замедлению обменных процессов. Из-за этого снижается скорость избавления от лишнего веса.
  • Витамины группы В. Они влияют на пищеварительные процессы и состояние нервной системы. Благодаря им у организма есть возможность лучше противостоять стрессу. А это, в свою очередь, помогает справиться с неконтролируемым чувством голода.
  • Лактоза. Это молочный сахар, который относится к категории быстрых углеводов. При их употреблении уровень сахара в крови резко повышается, а затем также быстро падает. Это приводит к непреодолимому чувству голода.
  • Минеральные вещества. Это марганец, медь, селен, фосфор, хром и прочие полезные для организма составляющие.

Точную калорийность каждого вида молока стоит рассмотреть отдельно. Ведь они достаточно существенно различаются из-за своего индивидуального состава.

Калорийность

Рассмотрим подробно основные виды молока и сравним их калорийность.

  • Коровье. В 100 граммах этого молока содержится около 60 килокалорий.
  • Козье. На 100 грамм приходится около 68 килокалорий.
  • Безлактозное. Стоит отметить, что его употребление при похудении не рекомендуется. Ведь вместо лактозы туда добавляют обычный сахар, который является главным врагом при снижении веса. На 100 грамм продукт приходится около 40 килокалорий.

Что касается соотношения белков, жиров и углеводов, оно зависит опять же от вида молока, способа его обработки и срока годности. Все эти данные легко можно найти на каждой пачке молока и выбрать для себя оптимальное соотношение.

Польза и вред

Начнем с полезных свойств молока.

  • Нормализация обмена веществ. Самая важная составляющая успешного похудения – это хороший обмен веществ. А большое содержание кальция в молоке как раз способствует улучшению этого процесса.
  • Мочегонные свойства. Вместе с жидкостью из организма будут уходить все вредные продукты распада. Этот процесс будет полностью естественным. Он не будет оказывать отрицательного влияния на работу сердечно-сосудистой системы.
  • Нормализация работы иммунной системы. Если употреблять молоко во время диеты, защитные силы организма не будут давать никаких сбоев. Так что организму не будут грозить никакие вирусные заболевания и обострение хронических недугов.
  • Быстрая насыщаемость. Благодаря животному белку, который содержится в молоке, происходит быстрое насыщение организма.
  • Избавление от бессоницы.
  • Снижение артериального давления.
  • Нормализация работы эндокринной системы.

Несмотря на то что жирность натурального молока довольно высока, это не представляет особой опасности. Эти жиры содержат необходимые для нормальной работы кишечника кислоты и способствуют понижению уровня холестерина в крови.

Теперь перейдем к вредным свойствам напитка.

  • Содержание лактозы. Лактоза – это сахар. После употребления сахара увеличивается выработка инсулина, что приводит к накапливанию лишнего жира. К тому же есть люди с индивидуальной непереносимостью лактозы.
  • Потеря полезных свойств при промышленной обработке.
  • Содержание вредных веществ. В молоке, представленном на прилавках супермаркетов, могут содержаться и антибиотики, и патогенные микроорганизмы. Также могут встретиться пестициды, токсины и радионуклиды.

Какое подходит?

Самыми распространенными видами молока на отечественных прилавках являются коровье и козье. Также существуют обезжиренные и сухие варианты. Свойства у каждого из них особые. Ниже рассмотрим их более подробно.

  • Коровье. Самое популярное, его можно купить абсолютно везде. Про его калорийность было рассказано выше, а теперь опишем его состав. В нем содержится большое количество кальция. Больше, чем в других видах молока. Также оно содержит большое разнообразие витаминов и минералов. А вот жиров в коровьем молоке не так много.
  • Козье. Не уступает коровьему по количеству полезных для организма веществ. В особых случаях его используют даже вместо материнского молока.
  • Обезжиренное. Или, как его еще называют, низкокалорийное. Считается самым лучшим вариантом при уменьшении веса. Современное молочное производство позволяет понижать уровень жирности и при этом не терять полезные вещества. Производители научились сохранять количество витаминов и микроэлементов в молоке после переработки на прежнем уровне. В особых случаях происходит искусственное обогащение молока всем необходимым.
  • Сухое. Это порошкообразный продукт. Его категорически не рекомендуют к употреблению не только во время похудения, но и при обычном режиме питания. Оно лишено всех полезных свойств, но зато имеет высокую калорийность.

Особенности употребления

Молоко не приносит вреда фигуре, но также и не способствует замедлению процесса похудения. Но при его употреблении нужно учитывать некоторые нюансы.

Норма по количеству

Применительно к обезжиренному молоку особых ограничений нет. Оно не содержит в себе большого количества калорий, так что не способно значительно увеличить вес. Но при употреблении обычного молока или продукта с высоким процентом жира нужно за количеством следить.

Вообще, рекомендованная норма составляет около 500 миллилитров напитка в день. То есть достаточно выпивать по два стакана напитка ежедневно.

В какое время можно пить?

У молока нет никаких особых ограничений по употреблению в определенное время суток. Но стоит помнить о некоторых особенностях его употребления.

Молоко должно быть отдельным приемом пищи, поскольку в одном стакане содержится существенное количество калорий. Если выпить стакан во время ужина, можно сильно увеличить его калораж, что отрицательно скажется на процессе снижения веса.

Продукт лучше употреблять за два часа до сна. За это время оно полностью усвоится, и желудку не придется работать ночью во время отдыха всего организма. Лучше выпить теплое молоко. Оно поможет успокоиться и быстро заснуть.

Также молоко очень полезно пить перед тренировкой. Физическая активность позволит молочному сахару преобразоваться в энергию, а не в жир. Это поможет увеличить уровень выносливости и сжечь большее количество калорий во время тренировки. Можно выпить продукт и после тренировки. Казеиновый белок поможет мышцам быстрее восстановиться.

Сочетание с другими продуктами

Вообще, самым лучшим вариантом считается употребление молока в качестве самостоятельного блюда. Но допустимо его сочетание с некоторыми другими продуктами.

Молоко категорически не стоит пить вместе с мучными изделиями. Поскольку в нем содержится высокий уровень протеина, оно будет плохо перевариваться и нарушать работу желудочно-кишечного тракта. При его потреблении вместе с мясом или продуктами, содержащими большое количество углеводов, есть риск образования токсинов. Они способны серьезно навредить организму. Поэтому не стоит есть углеводы и мясо вприкуску с молоком.

Теперь рассмотрим самые популярные варианты сочетаний молока с другими продуктами и отметим положительные и отрицательные.

  • Чай. Долгое время такой вариант считался очень полезным для организма. Но после нескольких проведенных исследований было обнаружено, что белок казеин, которым так богато молоко, разрушает антиоксиданты чая. Но не стоит думать, что этот напиток приносит организму вред, вовсе нет. Просто одни полезные свойства компенсируются другими.
  • Кофе. При похудении предпочтение стоит отдавать свежим кофейным зернам в сочетании с обезжиренным молоком. В день лучше выпивать не более трех чашек этого многими любимого напитка.
  • Каша. Это один из лучших вариантов для завтрака вне зависимости от того, хотите вы потерять вес или нет. Это блюдо помогает зарядиться необходимым количеством энергии на весь предстоящий день. Также содержит в себе много полезных для организма белков. Молоко можно сочетать практически с любыми видами круп, но самым лучшим вариантом считается гречневая и овсяная.
  • Коктейли. Полезно выпивать их перед сложными физическими нагрузками. Для активного похудения прекрасным вариантом считается коктейль с цитрусовыми, например, с апельсином или грейпфрутом.
  • Сыворотка. Содержит в себе ничтожное количество калорий и имеет практически нулевой процент жирности. При этом сохраняет полный состав минералов и витаминов. При приготовлении сыворотки самостоятельно придется постараться, ведь процесс этот довольно трудоемкий, но результат будет того стоить.
  • Куркума. Эта смесь обладает замечательными антисептическими и антибактериальными свойствами. Лучше всего употреблять ее при каких-либо недомоганиях.
  • Имбирь или мед. Значительно увеличивает скорость обмена веществ, так что очень полезно при похудении. Также помогает при ОРВИ и простудах, в период сезонной нехватки витаминов.
  • Кардамон или мускатный орех. Помогает успокоиться и нормализовать сон.

Отзывы

Практически в любой семье есть своя культура потребления этого напитка, будь то добавление в чай или кофе или употребление в качестве самостоятельного продукта. Когда человек хочет похудеть, для него нет особо смысла убирать молоко из своего рациона полностью.

Люди, которые использовали правильный подход к диетам, отмечают, что употребление молока никак не мешало им сбросить вес. Ведь при его потреблении нужно следить за общей калорийностью рациона, и тогда оно не станет препятствием на пути к фигуре мечты.

О том, можно ли пить молоко при похудении, смотрите в следующем видео.

Узнаем можно ли пить молоко при похудении? Сколько калорий в стакане молока? Диета на неделю для похудения

Перед диетой люди, желающие похудеть, начинают задумываться о пользе или вреде того или иного продукта. Однако в период снижения веса организму необходимы витамины и минеральные вещества, а также белок. Можно ли пить молоко при похудении? Диетологи сошлись во мнении, что продукт не только важен для снижения веса, но и способен оздоровить организм.

Допустимо ли молоко при похудении

При соблюдении диеты или сбалансированного питания люди изучают состав и полезные свойства многих продуктов. Это делается для того, чтобы эффективно снизить вес. Для того чтобы процесс похудения проходил быстро, необходимо включить в рацион белки.

Можно ли пить молоко при похудении? Это делать полезно, ведь именно в этом продукте содержится белок, так необходимый в момент жесткого ограничения меню. Многие диетологи уверены, что молоко важно не только для похудения, но и для оздоровления организма.

К единственному исключению можно отнести индивидуальную непереносимость лактозы.

При выборе молока для похудения необходимо учитывать его жирность. Лучше всего остановиться на менее калорийном продукте, но и обезжиренный вариант в данном случае не подойдет.

Последние исследования ученых подтверждают следующее. Люди, которые постоянно пьют жирное деревенское молоко, намного реже страдают лишним весом.

Действие на организм продукта впечатляет. Без молока любое питание нельзя назвать сбалансированным.

Сколько кальция в молоке? Этот показатель продукта зависит от его вида и обработки.

Напиток не только источник белка, но в нем содержатся и аминокислоты, витамины, минералы. Молоко, заполняя желудок, способно подавить аппетит и вызвать быстрое насыщение.

Белок, содержащийся в продукте, быстро усваивается. Молоко отлично влияет на пищеварительную систему и ускоряет метаболизм. Кальций, содержащийся в напитке, ускоряет выработку гормонов, которые сжигают жир.

При снижении веса молоко особенно полезно пить после тренировки. В это время организму для восстановления мышечной массы требуется белок. Именно поэтому молоко используют в качестве одного из компонентов различных спортивных добавок.

Состав молочного продукта

В молоке содержится много питательных веществ. В его состав входит около 100 всевозможных компонентов, среди которых минеральные вещества, аминокислоты, витамины, молочный сахар и другие. Некоторые из них не синтезируются в человеческом организме.

Молочные белки обогащают организм незаменимыми аминокислотами, которые поступают только с пищей. К такому виду веществ относится метионин. Он положительно действует на работу печени.

Входящие в состав молока вещества способствуют укреплению иммунитета и обеспечивают надежную защиту от бактерий.

Молоко — один из основных источников кальция. С возрастом он вымывается из костей, что приводит к их хрупкости. Лактоза, входящая в состав продукта, обеспечивает хорошее усвоение кальция.

В продукте присутствую витамины: E, A, K, Д и группы В. Также молоко богато фолиевой и пантотеновой кислотой, биотином.

Сколько кальция в молоке? Количество элемента на 100 г продукта с жирностью 2,5-3,5 % составляет 100 мг. В обезжиренном молоке: на 100 г приходится 120 мг.

Плюсы и минусы

Каковы польза и вред молока для организма? К положительным свойствам продукта можно отнести:

  1. Молоко полезно для предотвращения анемии, заболеваний сердца и сосудов.
  2. Благодаря кальцию и витамину Д оно положительно действует на зрение, укрепляет иммунитет и нормализует микрофлору кишечника.
  3. В период кормления грудью молоко помогает женщине наладить лактацию.
  4. Продукт предотвращает болезни почек и легких.
  5. Благодаря калию увеличивается эластичность сосудов.
  6. При постоянном употреблении по 500 мл молока в день человек восполняет необходимые запасы кальция на 70 %.
  7. Продукт нормализует пищеварительные процессы в организме.
  8. Молоко используется для похудения, а также в лечебно-диетическом питании.

Существуют ситуации, когда употребление продукта может привести к отрицательному влиянию на организм.

Молоко не следует употреблять в таких случаях:

  • При непереносимости продукта и лактозы.
  • При нулевой или низкой кислотности желудка. В таком случае лучше всего пить кисломолочные продукты.
  • При сахарном диабете.
  • Детский возраст до года.

Чрезмерное употребление молока может привести к набору веса, проблемам с пищеварением. Поэтому в период похудения нужно учитывать необходимое количество продукта и не превышать норму без надобности.

Виды молока

Продукт разделяют на несколько видов. Магазинное молоко не настолько полезно, как домашнее. Известны несколько его разновидностей.

В коровьем молоке содержится более 20 витаминов, один из минусов — высокая калорийность. Продукт способен полностью обеспечить человеческий организм кальцием. В состав коровьего молока входят: сахариды (4,8 г), жиры (4,6 г), вода (88,3 г), белки (2,9 г) и органические кислоты (зола — 0,7 г).

Что значит пастеризованное молоко? В этом случае продукт подвергается специальной обработке и сохраняются все полезные вещества.

В коровьем молоке присутствуют витамины А, В, D, С, Е, РР, Н. Также в продукте содержится много минеральных веществ.

Сколько калорий в стакане молока? В 200 мл содержится 120 ккал.

Козье молоко обладает своими особенностями, в его составе содержится повышенное количество витамина А. Ученые считают его продуктом, который способен восстановить жизненные силы. Жирность козьего молока выше коровьего и составляет 4 %. Однако организм полностью усваивает жиры, и они не способствуют набору веса. Калорийность козьего молока составляет 64-68 ккал.

К ценным веществам, входящим в состав козьего молока, относят: калий, кобальт, фосфор, витамины группы В и С. Поэтому продукт особенно полезен при похудении.

В безлактозном молоке присутствует много сахара. Диетологи не рекомендуют употреблять его при похудении. Сахар в его составе не способствует потере веса. В стакане безлактозного молока присутствует 10 г углеводов.

Какое молоко лучше пить

К основным критериям, по которым различают молоко, относится его жирность. В настоящее время растет тенденция к получению стройной фигуры. Поэтому производители разрабатывают множество видов маложирного продукта, который по своим параметрам не отличается от обычного. К разновидностям магазинного молока относят продукты, имеющие:

  1. Жирность 0,1 %. Такой продукт получается путем отделения сливок от всего натурального молока. Его преимуществом является присутствие витаминов группы В, минеральных веществ (калий, цинк, йод). Обезжиренное молоко менее калорийное, подходит для людей с избыточным весом. Продукт считается диетическим, и в санаториях в меню включают именно его.
  2. Жирность 0,5 %. Молоко отличается богатым составом. В продукт входят витамины D, А, РР, С, В и минеральные вещества (кальций, калий, фосфор). Молоко используется при лечебно-диетическом питании. С успехом применяется людьми, желающими похудеть. Молоко легко усваивается организмом и может использоваться для приготовления йогуртов, коктейлей.
  3. Жирность 0,7 %. Молоко включает в свой состав значительное количество витаминов, минералов и аминокислот. Продукт также рекомендован людям в период похудения. Перед покупкой молока необходимо получить информацию о способе производства и изготовителе, потому что оно выпускается единичными производителями.
  4. Жирность 1 %. Химический состав такого молока просто уникален. Продукт насыщен витаминами, минералами и другими веществами. Его рекомендуется употреблять при диетическом питании.
  5. Жирность 1,5 %. В молоке содержатся важные макро- и микроэлементы, витамины. Продукт отлично подходит для людей, стремящихся стать стройными, особенно для разгрузочных дней.
  6. Жирность молока 2,5 %. Белки, жиры, углеводы присутствуют в продукте в следующем соотношении 2,8:2,5:4,7. Продукт относится к наиболее употребляемым и любимым среди населения. Молоко отлично усваивается и положительно влияет на пищеварительную систему.
  7. Что значит пастеризованное молоко? Процесс позволяет увеличить длительность хранения молока. При этом молоко с жирностью 3,2 % сохраняет все свои полезные свойства. В его состав входят витамины, минералы и другие полезные вещества. Молоко употребляют в натуральном виде и готовят на нем различные блюда.
  8. Жирность 3,5 %. Продукт положительно действует на работу мозга, на почки, печень, пищеварительную и нервную системы. Молоко отлично усваивается, но лучше всего его употреблять в качестве отдельного блюда. Продукт отлично утоляет чувство голода. Даже незначительное количество молока надолго избавляет от желания покушать. Это происходит благодаря его жирности.

Для похудения к более полезному молоку относят пастеризованное из-за его полезного состава. Предпочтительная жирность продукта — 1,5-2,5 %.

Почему не следует пить обезжиренный продукт

Если пить обезжиренное молоко при похудении, то можно нанести вред своему здоровью. Ведь без жирных кислот в организме не будет усваиваться кальций.

Жиры в молоке позитивно влияют на работу иммунитета и стимулируют обмен веществ. Они дают ощущение сытости и являются источником энергии. Поэтому худеющим не следует использовать обезжиренные продукты.

Жесткая методика

Диета на неделю для похудения состоит из употребления в этот период только молока. Согласно отзывам похудевших, прием продукта должен осуществляться, начиная с 8 утра и заканчивая 8 вечера.

Сколько калорий в стакане молока? Это можно высчитать по такой формуле: на 100 г продукта в среднем приходится 60 ккал.

Особенности строгой диеты:

  • первый день — стакан молока каждые 2 часа;
  • второй день — 200 мл продукта каждые 1,5 часа;
  • 3 день — стакан молока через 1 час.

В оставшиеся дни продукт пьют по стакану через каждые 30 минут. Из-за жесткого ограничения в питании выходить из монодиеты необходимо постепенно. В первые 2 дня после диеты пьют по 200 мл молока каждые 2 часа, во второй половине дня употребляют легкие салаты из овощей.

В результате диеты можно потерять 4-5 кг лишнего веса. В этот период худеющие должны следить за своим самочувствием. Любая монодиета несет потенциальную угрозу для организма. Молоко — полезный продукт, но все необходимо делать в меру.

Лучше всего перед диетой получить консультацию специалиста. Он даст необходимые рекомендации и поможет разработать лучший режим питания.

Щадящая диета

Применяя полезные свойства молока, диетологи смогли разработать различные методики похудения. Главным компонентом систем питания становится молочный продукт.

С понедельника по четверг рацион следующий:

  • Завтрак. 250 г брынзы, 2 ч. ложки меда, чай или негазированная вода, 1 обезжиренный йогурт.
  • Обед и ужин. Худеющий выбирает пищу самостоятельно с учетом правил правильного питания.

В пятницу меню диеты следующее:

  1. Завтрак. Натощак стакан теплой воды с лимоном. На завтрак — стакан молока с какао и 1 ч. ложкой меда.
  2. Перекус. 1 апельсин или грейпфрут. 1 литр воды выпить небольшими порциями постепенно.
  3. Обед. Нежирный стейк из мяса или рыбы с зеленью.
  4. Полдник. Йогурт с медом.
  5. Ужин. Чашка овощного бульона. Через 20 минут необходимо съесть немного вареных овощей.

В субботу рацион питания следующий:

  • Завтрак. За 2 часа нужно выпить 1,5 литра воды.
  • Обед. Сок грейпфрута, стакан молока с медом и какао, овощной бульон.
  • Полдник. Йогурт с медом.
  • Ужин. Запеченная рыба с овощным салатом.

В воскресенье меню включает:

  1. Завтрак. 2 стакана воды, сок грейпфрута, молоко с медом.
  2. Обед. Филе рыбы с зеленью.
  3. Полдник. 1 литр воды выпить постепенно.
  4. Ужин. Картофель запеченный. Перед сном — йогурт с медом.

Диета на неделю для похудения позволит избавиться от 4-6 кг.

Как правильно употреблять

Можно ли пить молоко при похудении? В период диеты необходимо обратить внимание на следующие аспекты:

  • Этот продукт желательно пить отдельно, не следует смешивать с другой пищей, особенно с кислыми фруктами.
  • Пить молоко лучше всего за 2 часа до или после приема пищи.
  • Калорийность различных видов продукта отличается.
  • Полезней всего пить натуральное цельное молоко.
  • Лучше всего избегать продуктов с высоким содержанием сахара. К ним относится сгущенное и сухое молоко.

Если молоко пить для похудения на ночь, то это нужно делать за 1,5 часа до сна. За этот период времени начнет действовать аминокислота триптофан. Она представляет собой натуральное успокоительное и помогает бороться с нарушениями сна.

Молоко — питательный напиток, который поможет справиться с приступами голода в период диеты.

С чем сочетается молоко

Чай с молоком для похудения ранее считался одним из наиболее полезных напитков. Однако последние исследования показали, что это не так. Белок казеин способен блокировать антиоксиданты чая. Однако напиток все равно остается полезным. Ведь снижение действия одних полезных веществ компенсируется увеличением пользы других.

Для утоления жажды лучше всего воспользоваться зеленым чаем, а для повышения тонуса — черным.

Пить или нет чай с молоком для похудения, решает сам человек, исходя их своих предпочтений.

Противопоказания

Молоком нельзя злоупотреблять, потому что это может привести к негативной реакции организма. В результате возникает тошнота, расстройство стула, проблемы с сосудами и другое. Это может быть вызвано индивидуальной непереносимостью лактозы.

Чтобы не отказываться от молочных продуктов, можно воспользоваться кефиром, ряженкой или сывороткой.

Не рекомендуется употреблять продукт людям старше 40 лет. Ведь в это время замедляются обменные процессы.

Отзывы

Многие худеющие, включив в систему питания молоко, поняли, как можно легко похудеть вместе с ним. Отзывы этой категории людей полностью положительны. Они смогли избавиться от лишнего веса, даже если пытались безуспешно это сделать на других диетах.

Второй группе худеющих не удалось снизить вес на молоке из-за индивидуальной непереносимости.

Заключение

Можно ли пить молоко при похудении? Продукт употреблять нужно, но обязательно учитывать его калорийность и жирность. При желании можно худеть на монодиете или совмещать употребление молока с другими диетическими блюдами.

Молоко сгущенное с сахаром нежирное – калорийность и применение в диетах

Молоко сгущенное с сахаром нежирное – полезный и очень питательный продукт. Его получают из цельного коровьего молока путем удаления части воды с дальнейшей обработкой. Несмотря на то, что молоко для сгущения подвергают термической обработке, оно сохраняет все полезные свойства цельного молока. Есть несколько способов приготовления молоко сгущенного с сахаром нежирного. Классический способ: молоко обезжиренное пастеризуют, а после этого выпаривают несколькими способами. После этого добавляют концентрированный сахарный сироп и отправляют на сгущение. Сгущенное молоко стерилизуют, что способствует длительному сроку хранения. Второй способ: производство рекомбинированного сгущенного молока, сырьем для которого служит обезжиренное сухое молоко, жиры, сахарный песок и питьевая вода. В молоке сгущенном с сахаром нежирном содержится много полезных элементов и витаминов:

  • Витамины группы В, С, А, РР, Н, Е, D.
  • А также кальций, фосфор, железо, магний;
  • йод, калий, сера и селен.

Вследствие того, что данное сгущенное молоко нежирное, кальций усваивается в больших количествах (чем молоко жирнее, тем усвояемость кальция меньше).

В 100г продукта содержится:

  • Вода – 33,2.
  • Белки – 1,8.
  • Жиры – 0.
  • Углеводы – 58.
  • Ккал – 272.

Полезные свойства сгущенного молока

  • Сгущенное молоко усваивается организмом лучше цельного, поскольку в последнем имеется лактоза, которую некоторые люди не могут употреблять.
  • В сгущенном молоке длительное время сохраняются все полезные свойства молока.
  • Можно укрепить иммунитет, съедая ежедневно 1-2 ложки сгущенного молока.
  • Минералы и витамины, которые содержатся в молоке, помогают восстановить утраченные физические и умственные силы.
  • Сбалансированные соли фосфора, входящие в состав молока улучшают деятельность мозга, восстанавливают кровь.

Сгущенное молоко и диетическое питание

Как бы нам не хотелось, чтоб сгущенка была диетическим продуктом, но, к сожалению, присутствие количества сахара и калорий в данном продукте, даже если он нежирный такова, что мечтая похудеть с употреблением сгущенного молока, не получится. Единственное, что можно позволить – это один раз в день вместо сахара в чай или кофе мешать ложечку любимого лакомства.

Для тех, кто сидит на диете и мечтает о сгущенном молоке, предоставляем рецепт сгущенки для похудения, которую можно приготовить в домашних условиях.


Рецепт диетического сгущенного молока:

  • 250 мл обезжиренного молока.
  • 150г обезжиренного сухого молока.
  • По вкусу заменитель сахара.

Приготовить водяную баню. Все ингредиенты перемешать и на водяной бане варить не меньше 2 часов. Когда остынет перелить в баночку и поставить в холодильник. Когда сгущенка загустеет ее можно употреблять во время диеты и после, чтоб не набрать лишние килограммы.

Необходимо знать
  • В продаже, к сожалению, очень много фальсифицированного сгущенного молока.
  • Зачастую нерадивый производитель заменяет основные продукты заменителями ради наживы, и главный враг – пальмовый растительный жир, который очень вреден для организма, а также добавляют пищевые белила, клейкое вещество Е466, заменители сахара.
  • Внимательно изучайте состав сгущенного молока, которое хотите купить, там должно быть натуральное цельное молоко и сахар.

Диета при химиотерапии — Онкоцентр

Главная » Пациентам » Полезные материалы » Диета при химиотерапии

Применение сильнодействующих противоопухолевых препаратов практически всегда сопровождается различными побочными явлениями, о которых больным необходимо знать, чтобы уметь их предупреждать или противостоять им с помощью специальных лекарственных средств, а также диеты и образа жизни. В частности, химиотерапия нередко оказывает неблагоприятное влияние на органы пищеварительного тракта, что препятствует нормальному питанию пациента. Но одним из непременных условий для назначения и успешного действия противоопухолевых препаратов является общее хорошее состояние больного, которое во многом как раз зависит от правильного питания. И больные, использующие сбалансированную рациональную диету, легче противостоят побочным явлениям лекарственной терапии.

При отсутствии заболеваний желудочно-кишечного тракта, печени и поджелудочной железы мы рекомендуем диету, включающую продукты питания из четырех групп: белковой, молочной, хлебно-крупяной и фруктово-овощной. Ежедневный пищевой рацион больного должен содержать продукты из этих групп как во время химиотерапии, так и в перерывах между курсами.

Белковая группа: фасоль, горох, орехи, соевые продукты, яйца, рыба, мясо (телятина, говядина, свинина, птица) и печень. Продукты этой группы содержат белок, а также витамины группы В и железо. В течение дня желательно дважды включать в рацион продукты этой группы. Это может быть, например, чашка вареной фасоли или два яйца, или 60-90 граммов мяса, рыбы, птицы и т.д.

Молочная группа: кефир, свежая простокваша, ряженка, йогурт, творог, молоко, сыр, сливочное масло, сгущенное молоко и т.д. Выбор определяется предпочтением больного. Считается, однако, что молочнокислые продукты полезнее, особенно те, что обогащены бифидобактериями. Продукты питания этой группы содержат важные витамины, а также кальций и белок. Необходимы два приема молочных продуктов в день. Например, стакан кефира или простокваши, 30 граммов сыра или 90 граммов творога, либо стакан молока, 1/3 чашки несладкого сгущенного молока или 1/3 брикета мороженого и т.п.

Фруктово–овощная группа включает все виды сырых и отварных овощей, салатов и фруктов, а также соки и сушеные фрукты. Она особенно полезна в дни введения противоопухолевых препаратов. Желательно 4-5 приемов в сутки. Рекомендованы цитрусовые (грейпфруты, мандарины или апельсины), яблоки и любые другие фрукты и ягоды, содержащие витамин С; овощи – кабачки, баклажаны, различные виды капусты (белокочанная, цветная, брюссельская), сладкий перец, свекла, обязательна морковь. Полезна зелень — салат, укроп, петрушка, зеленый лук, сельдерей и т.д. Каждый прием состоит из свежих фруктов или стакана фруктового или овощного сока ( можно смешать по полстакана морковного и свекольного сока), а также салата из сырых или вареных овощей.

Хлебно–крупяная группа включает хлеб, зерновые и крупяные продукты (овсяные, кукурузные и пшеничные хлопья), разнообразные каши, печенье, «соломки» и т.п. Каши по степени полезности можно расположить в следующем порядке: гречневая, толокно, овсяная, манная, ячневая, полтавская, рисовая. Продукты этой группы обеспечивают организм углеводами, витамином В1. Необходимы 4 приема в день. Каждый прием может содержать кусочек хлеба или 2 печенья, полчашки каши, макароны, лапшу.

К указанной диете следует добавить сливочное или растительное масло, сметану или майонез, чтобы повысить калорийность пищи.

При любой диете во время химиотерапии — в перерывах между ее курсами и после ее завершения — обязательно нужно ежедневно принимать поливитамины. Целесообразно сочетать прием поливитаминов с аскорбиновой кислотой.

Во время проведения химиотерапии желательно увеличить количество жидкости, употребляя овощные, фруктовые и ягодные соки. Целесообразность этого значительно возрастает при лечении препаратами платины. Особенно полезны морковный, свекольный, томатный, малиновый и брусничный соки.

При отсутствии отеков или заболевания почек с нарушением выделительной функции следует выпивать 1,5-2 литра жидкости в день: минеральная вода, чай, молоко, лимонный и другие напитки. При отеках, наличии жидкости в брюшной или плевральной полости количество выпитой жидкости должно быть уменьшено и не должно превышать более чем на 300 мл количество выделенной мочи.

Информация о пищевой ценности сгущенного молока

Сгущенное молоко с добавлением насыщенных жиров и калорий придает десертам богатую сливочную сладость.

Кредит изображения: Teen00000 / iStock / GettyImages

Неудивительно, что сгущенное молоко с сахаром калорийно. В конце концов, он используется в качестве ингредиента в некоторых очень богатых десертах. Однако, что касается сладостей, сгущенное молоко обладает некоторыми положительными качествами, а именно питательными веществами, которые оно получает из сухих веществ молока, из которых оно сделано. Ключ к употреблению сгущенного молока как части здорового питания — это употребление небольших дозированных порций.

Сгущенное молоко калорий

Сгущенное молоко с сахаром — отличное лакомство, так как оно содержит 62 калории на простую столовую ложку. Сгущенное молоко очень калорийно по той причине, что подразумевает его название — это густая смесь сухих веществ молока и сахара. Люди, соблюдающие диету, должны либо избегать сгущенного молока с сахаром, либо употреблять его очень разумно.

Концентрированный источник жира

Согласно Национальной базе данных по питательным веществам Министерства сельского хозяйства США, порция обычной сгущенного молока с сахаром содержит почти 2 грамма жира. Жир в сгущенном молоке — это в первую очередь насыщенные жиры, которые могут негативно повлиять на здоровье сердечно-сосудистой системы.

При употреблении сгущенного молока с сахаром легко съесть значительное количество насыщенных жиров, если не следить за порциями. Сгущенное молоко — лучший выбор, чем сливки, в которых их 5.5 граммов жира на столовую ложку. Вы можете купить обезжиренную и обезжиренную версию сгущенного молока с сахаром, если будете следить за потреблением жира.

Белки и углеводы в сгущенном молоке

Столовая ложка сгущенного молока с сахаром содержит более 10 граммов углеводов, все из которых находятся в форме сахара. Согласно списку ингредиентов на типичной банке сгущенного молока с сахаром, единственными двумя ингредиентами являются молоко и сахар. Хотя часть сахара в этом сладком продукте поступает из молока, большая часть — из добавленного сахара.

Согласно данным Harvard Health Publishing, диета с высоким содержанием добавленного сахара может привести к проблемам с весом, сердечно-сосудистым заболеваниям и диабету. Американская кардиологическая ассоциация рекомендует женщинам ограничивать потребление добавленного сахара до 6 чайных ложек или 25 граммов в день, а мужчинам — до 9 чайных ложек или 36 граммов в день.

Это суперсладкое лакомство также содержит белок, хотя и не очень много: в 1 столовой ложке содержится около 1,5 грамма. Соблюдайте осторожность при употреблении десертов, содержащих сгущенное молоко, поскольку они могут содержать количество сахара, которое вы считаете неприемлемым для контроля уровня сахара в крови или плана похудания.

Подробнее: Низкоуглеводный заменитель сгущенного молока

Хороший источник кальция

Неудивительно, что одним из основных питательных веществ, которые вы найдете в сгущенном молоке, является кальций — 54 миллиграмма на столовую ложку. Сгущенное молоко также содержит 71 миллиграмм калия, 5 миллиграммов магния, 51 международную единицу витамина А и следовые количества других витаминов и минералов.

Подсластите свои десерты

Сгущенное молоко с сахаром используется для придания сладости и богатой кремовой текстуры некоторым десертам.Если его комбинировать с кислыми ингредиентами, такими как лимонный сок, он загустеет сам по себе — без приготовления или охлаждения.

Многие люди также используют сгущенное молоко для подслащивания напитков, особенно кофе. Сгущенное молоко также можно варить в течение длительного периода времени и давать ему карамелизироваться. Карамель, также известная как dulce de leche во многих регионах США и Мексики, используется в качестве начинки для мороженого и добавляется в другие десерты.

Подробнее: Как приготовить сгущенное молоко с сахаром

Сгущенное молоко и сгущенное молоко

Сгущенное молоко иногда путают со сгущенным молоком.Хотя эти два продукта проходят аналогичный процесс испарения, в результате которого получается продукт с высокой плотностью сухих веществ молока, их питательные профили сильно различаются.

В сгущенное молоко добавлен сахар, а в сгущенное молоко нет. Из-за сахара сгущенное молоко имеет густой и вязкий вид и прилипает к ложке или оседает на дне чашки, если его не перемешать тщательно.

Сгущенное молоко полезно для здоровья?

Ах! Сгущенное молоко — основная суть многих индийских сладостей, таких как кхир, рабри, кулфи и т. Д.и некоторые десерты, такие как пирожные и помадка. Его сочная кремовая текстура и сладкий вкус могут соблазнить любого, от ребенка до взрослого. От кремового до бледно-желтого густого цвета, это полужидкий препарат, который получают путем удаления большей части воды из коровьего молока. К этому сахар добавляют в основном в качестве консерванта. Одним из преимуществ использования сгущенного молока в индийских сладостях является сокращение времени приготовления по рецепту и добавление насыщенности сладкому.

Информация о пищевой ценности сгущенного молока:

½ стакана сгущенного молока около 160 граммов
RDA означает рекомендуемую дневную норму.

Энергия — 513 калорий
Белки — 12,6 г
Углеводы — 86,7 г
Жиры — 13,8 г
Клетчатка — 0 г

См. Полную информацию о пищевой ценности сгущенного молока в глоссарии по сгущенному молоку, щелкнув здесь.

Насколько полезно сгущенное молоко?

Что ж, как ясно видно из приведенной выше таблицы, самое первое питательное вещество — энергия — само по себе очень высокое (513 калорий из ½ стакана).Это много! Это вызывает наибольшую озабоченность, особенно когда в основном это связано с добавлением сахара, который в действительности не приносит никакой пользы. Таким образом, любители веса и люди, страдающие диабетом и сердечными заболеваниями, а также те, кто придерживается здорового образа жизни, должны обязательно придерживаться этого ингредиента, хотя и богатого вкусом.

Итак, следующий вопрос, который может возникнуть: Насколько полезна сгущенка для набора веса ?

Здесь играют роль и другие питательные вещества.Сгущенное молоко — это молочный продукт, поэтому это концентрированный источник белка и кальция, которые необходимы для укрепления костей. Он также обеспечивает некоторые витамины группы B и калий. Таким образом, сгущенное молоко должно быть предпочтительнее простого сахара. Тогда лучше всего приготовить кашу быстрого приготовления с овсяными хлопьями и небольшим количеством сгущенки.

Однако вы также должны помнить, что в конечном итоге он содержит сахар и жир, что может привести к увеличению веса и может вызвать воспаление в вашем теле, если употреблять его часто и в избыточных количествах.И лишний вес в большинстве исследовательских работ всегда оказывался одной из основных причин таких заболеваний, как диабет, болезни сердца и так далее….

Таким образом, сгущенное молоко — это не то, что можно было бы пропагандировать, но это переизбыток сахара, если добавить всего лишь столовую ложку. чашка кофе изредка принесет меньше вреда вашему телу. Добавление целой банки для торта или рабри скорее будет считаться виноватым удовольствием. Теперь выбор за вами.

Что лучше для вас?

Многие люди, часто употребляющие молоко, не могут различить сгущенное молоко и сгущенное молоко .Они часто принимают эти виды молока друг за друга, потому что они очень похожи. Но лишь небольшая разница повлияет на эффективность молока. В этой статье мы поможем вам отличить сгущенное молоко от сгущенного молока .

Сгущенное молоко и сгущенное молоко: в чем разница?

Все мы легко различаем свежее молоко и цельное молоко. Однако на рынке представлено много видов цельного молока. Наиболее распространены сгущенное молоко и сгущенное молоко .Не всем их легко отличить. В чем разница между этими двумя цельными молочными продуктами?

Сгущенное молоко

Сгущенное молоко — цельное молоко. Как следует из названия, в процессе обработки производитель удаляет 60% воды из молока. Таким образом, это молоко лишь немного гуще цельного молока. Сгущенное молоко имеет легкий карамельный цвет и вкус из-за процесса нагревания.

Хотя сгущенное молоко удалило воду, оно все еще сохраняет свои питательные вещества.В воде нет никаких веществ, поэтому это не влияет на качество молока.

Фактически, это молоко содержит больше питательных веществ, чем цельное молоко. Производители сгущенного молока обогащают молоко витамином D. Это улучшает кости и дух пользователя. Некоторые продукты также содержат витамин А или витамин С, чтобы удовлетворить потребности клиентов.

Сгущенное молоко

Это молоко на гуще сгущенного молока . Потому что в процессе удаления воды в цельное молоко добавляли сахар.Этот процесс вызывает реакцию концентрации молока.

Пищевая ценность сгущенного молока аналогична составу сгущенного молока. Кроме того, производители добавляют в сгущенное молоко дополнительные ингредиенты, такие как витамины A, C и D.

Единственная разница между сгущенным молоком и сгущенным молоком — это сахарный состав.

Процесс переработки сгущенного молока и сгущенного молока

Сгущенное молоко

Сначала производитель отделяет 60% воды в коровьем молоке, чтобы испарилось в молоко .Затем быстро остудите и добавьте витамины и стабилизаторы. Производственная линия тщательно упаковывается и стерилизуется. Сгущенное молоко стандарта должно содержать не менее 7,9% цельного молока и 25,5% ингредиентов цельного молока.

Тепловая обработка молока дает более слабый сладкий вкус и более темный цвет, чем сгущенное молоко. Сгущенное молоко содержит больше питательных веществ, чем сгущенное молоко. Есть много разновидностей молока без сыворотки. Производитель удалит жир. Затем добавьте соответствующие ингредиенты в соответствии с потребностями потребителя.

Сгущенное молоко

Производители молока проходят процесс декантации и стандартизации сырого молока. Затем нагрейте до 85–90 ° C (185–194 ° F) в течение нескольких секунд. Этот процесс нагрева убивает некоторые микроорганизмы и снижает расщепление жиров. Производитель добавляет в молоко сахар в правильных пропорциях.

Сахар продлевает срок хранения сгущенного молока . Тростниковый сахар увеличивает осмотическое давление жидкости. Этот процесс предотвращает рост микробов.Затем следует охлаждение сгущенного молока и удержание кристаллов сахара.

Кристаллизация сахара обычно происходит позже. Кроме того, сгущенное молоко также содержит дополнительные ингредиенты, такие как сгущенное молоко.

В процессе обработки сгущенное молоко удаляет воду, а сгущенное молоко содержит сахар

Преимущества сгущенного молока по сравнению с сгущенным молоком

Сгущенное молоко содержит много лактозы. Поэтому это плохой выбор для тех, кто худеет.Но это отличный ингредиент для приготовления десертов или кофе. Если ваша семья часто пьет кофе и завтракает с хлебом, стоит покупать сгущенное молоко.

Сгущенное молоко подходит для людей с диетическими потребностями для поддержания формы. Это молоко также следует употреблять людям с диабетом и жирами в крови. Если вам нужно воздержаться от сладкого, для здоровья следует использовать сгущенное молоко.

Хотя эти два вида молока питательны, их предполагаемое использование на самом деле различно.Вы должны выбрать тип молока, который подходит для предполагаемого использования, потому что они не взаимозаменяемы. При использовании сгущенки лучше всего добавлять воду, чтобы сгущенное молоко стало цельным.

Пищевая ценность сгущенного молока

Молоко имеет высокую пищевую ценность, обладает восхитительным вкусом и сладким вкусом. Использование сгущенного молока в ежедневном рационе поможет вам набрать здоровый вес. Набор веса с помощью сгущенного молока — одна из самых привлекательных и точных идей.

Основными ингредиентами сгущенного молока являются коровье молоко, сахар, жир и белок. Эти ингредиенты полезны для быстрого набора веса худым людям.

Кроме того, сгущенное молоко содержит некоторые витамины A, D и B1. Он очень подходит для борьбы с недоеданием и повышения сопротивляемости организма. Таким образом, сгущенное молоко в сочетании с некоторыми другими продуктами поможет вам легко набрать вес. Его можно разбавить, чтобы пить, есть в сочетании с хлебом или делать фруктовые смузи…

Однако использование слишком большого количества сгущенного молока приведет к обратным результатам.Вы должны знать, как использовать его для обеспечения ежедневного питания. Если вы хотите, чтобы сгущенное молоко максимально использовало его преимущества, вам следует:

  • Не пейте слишком много, это повлияет на пищеварительную систему
  • Пейте теплое молоко и высококачественное молоко.
  • Сочетайте упражнения и спорт для получения максимальной пользы
  • Правильная диета и сон
Сгущенное молоко имеет высокую пищевую ценность, обладает восхитительным вкусом и сладким вкусом.

Как использовать сгущенное молоко?

На самом деле, сгущенное молоко имеет другую цель, чем нутритивная поддержка.Некоторые ингредиенты сгущенного молока не богаты питательными веществами и не сбалансированы. Они просто незаменимый ингредиент приправы во многих сладостях и напитках. Вы также можете сочетать сгущенное молоко с продуктами, богатыми питательными веществами.

Использование сгущенного молока для многих целей становится все более популярным. Однако многие люди по-прежнему используют его неправильно по многим причинам, включая дезинформацию и привычки. Нам нужны четкие правила, как это сделали некоторые страны:

  • Четко укажите на этикетке, для чего используется сгущенное молоко, чтобы избежать путаницы?
  • Не рекомендуется детям до 2 лет
  • Общение, чтобы люди осознавали отклонения в питании детей младшего возраста, больных и пожилых людей
  • Ознакомьтесь с мероприятиями по поддержке молочного животноводства, такими как пожертвование молока детям из бедных семей
Вам следует внимательно ознакомиться с предполагаемым использованием на этикетке, чтобы выбрать правильный тип сгущенного молока для вас.

Выше представлена ​​разница в между сгущенным молоком и сгущенным молоком , а также некоторая информация о сгущенном молоке.Мы надеемся, что это будет полезно для вас и поможет вам различать эти два вида молока. Внимательно прочтите информацию о предполагаемом использовании на этикетке, чтобы выбрать подходящий для вас сорт молока.

Что такое сгущенное молоко | Organic Facts

Использование сгущенного молока довольно популярно во многих местах по всему миру благодаря его универсальности, плотности питательных веществ и небольшому количеству обычного молока.

Что такое сгущенное молоко?

Сгущенное молоко — это разновидность коровьего молока, из которого удалена большая часть воды, после чего остается густая молочная паста.Вы можете добавить воду в эту концентрированную пасту, чтобы получить обычное молоко, но оно имеет очень долгий срок хранения и его можно легко транспортировать в обезвоженном виде. Обычно вы найдете его в виде сгущенного молока с сахаром, так как в него обычно добавляют сахар для аромата. Эта альтернатива обычному молоку очень полезна в кулинарии, особенно в жирных десертах, благодаря своему сладкому вкусу. Эту форму молока следует употреблять в ограниченных количествах из-за высокой калорийности. [1]

Сгущенное молоко можно приготовить часами при бесконечном перемешивании.Фото: Shutterstock

Condensed Milk Nutrition

Этот тип обезвоженного молока содержит ряд впечатляющих питательных компонентов, в том числе 2 грамма жира и примерно 60 калорий на столовую ложку. Вы также получите твердую дозу аминокислот в сгущенном молоке, а также заметный уровень кальция, калия, магния и витамина А. Этот тип молока богат сахаром, но обеспечивает около 1,5 грамма белка на столовую ложку. Опять же, умеренность является ключевым моментом при потреблении этой альтернативы молоку, поскольку чрезмерное потребление может привести к ожирению, проблемам с сахаром в крови и сердечно-сосудистым заболеваниям. [2]

мг [кальций] ] [мг] [мг] µg [D] ] 9047 [мг] .16 9027 1 [г]

A Источники

A

A

Пищевая ценность


Молоко, консервированное, сгущенное, подслащенное

Размер порции: 100 г1 жидкая унция (38,2 г) 1 чашка (306 г)
Значение
Вода [г] 27,16
Энергия 321
Энергия [кДж] 1342
9027 9027 9027 9027 липид (жир) [г] 8.7
Зола [г] 1,83
Углеводы, по разнице [г] 54,4
Сахаров, всего, включая NLEA [г] 54,4
284
Железо, Fe [мг] 0,19
Магний, Mg [мг] 26
Фосфор, P [мг] 253
371
Натрий, Na [мг] 127
Цинк, Zn [мг] 0.94
Медь, Cu [мг] 0,02
Марганец, Mn [мг] 0,01
Селен, Se [мкг] 14,8
2,6
Тиамин [мг] 0,09
Рибофлавин [мг] 0,42
Ниацин [мг] 0,21 мг 0,21 0.75
Витамин B-6 [мг] 0,05
Фолат, общий [мкг] 11
Фолат, пищевой [мкг] 11
11
Холин, общий [мг] 89,1
Витамин B-12 [мкг] 0,44
Витамин A, RAE [мкг] 7466 9026 [мкг] 73
Каротин, бета [мкг] 14
Витамин А, МЕ [МЕ] 267
0 Витамин E (альфа-токоферол)
Витамин D (D2 + D3), международные единицы [IU] 6
Витамин D (D2 + D3) [мкг] 0,2
Витамин D3 (холекальциферол) [µg] 0,2
Витамин К (филлохинон) [мкг] 0,6
Жирные кислоты, всего насыщенные [г] 5,49
4: 0 [г] 6: 0 [г] 0,17
8: 0 [г] 0.1
10: 0 [г] 0,07
12: 0 [г] 0,18
14: 0 [г] 0,78
16: 0 [г] 2,4
18: 0 [г] 1,21
Жирные кислоты, общее количество мононенасыщенных [г] 2,43
16: 1 [г] 27 0,14
2,19
Жирные кислоты, общее количество полиненасыщенных [г] 0.34
18: 2 [г] 0,22
18: 3 [г] 0,12
Холестерин [мг] 34
0 Триптофан
Треонин [г] 0,36
Изолейцин [г] 0,48
Лейцин [г] 0,78
Метин 276 902 902 ] 0.2
Цистин [г] 0,07
Фенилаланин [г] 0,38
Тирозин [г] 0,38
9027 9026 Валин [г] 0,29
Гистидин [г] 0,21
Аланин [г] 0,27
Аспарагиновая кислота [г] 0,6
1.66
Глицин [г] 0,17
Пролин [г] 0,77
Серин [г] 0,43

Сгущенное молоко Использует сгущенное молоко

Благодаря универсальности и сроку годности сгущенное молоко стало фаворитом на многих кухнях и по рецептам, поскольку оно идеально подходит для различных десертов, холодного кофе и в качестве начинки для фруктов или несладкие блюда.

Десерты

Из-за концентрированной сладости и высокого содержания сахара в этом молоке, его часто используют при приготовлении десертов, в том числе тортов, печенья и пирожных. Он придает сливочную и гладкую текстуру насыщенным десертам, а также придает поджаренный оттенок, который используется в праздничной выпечке. [4]

Компонент напитка

Если вы хотите добавить сгущенное молоко в чай ​​или кофе со льдом, вы можете приготовить более густой и сливочный напиток с послевкусием более сладким, чем обычно.Это также отличный способ смягчить излишне горькие чаи или кофе. [5]

Фруктовый топпинг

Многим людям нравится использовать сгущенное молоко в качестве сладкой заправки для фруктовых салатов, поскольку оно может усилить определенные вкусовые качества. Кроме того, оно отлично подходит для намазывания фруктов перед тем, как поставить их в духовку, так как молоко ускоряет процесс карамелизации благодаря высокому содержанию сахара. [6]

Пикантные блюда

Хотя большинство рецептов с использованием сгущенного молока сладкие по своей природе, вы можете использовать это молоко в пикантных блюдах, например, в глазури или соусах для карри, белковых блюдах, шашлыках или других сливках. препараты.Сочетание сгущенного молока и кокоса дает восхитительный соус, который можно добавлять ко многим пикантным азиатским блюдам. [7]

Продукты | Сгущенное молоко

Сгущенное молоко с сахаром

В нашем НОВОМ закрывающемся пакете easy-pour!

Наше сгущенное молоко теперь доступно в закрывающемся пакете! Запечатываемый, с носиком, который легко наливать, наш новый пакет идеально подходит для повседневного использования и приготовления блюд.Получите ровно нужное количество для всех ваших любимых угощений, таких как кофе, чай, фрукты или овсянка, или утренний кекс. Или срежьте верх и используйте все 14 унций для рецепта.

Пищевая ценность

Размер порции: 2 TBSP (39 г)
Порций в упаковке: Около 10
Калорий на порцию: 130

Состав: МОЛОКО, САХАР.
Кошерная информация: D
Информация для аллергиков: СОДЕРЖИТ ИНГРЕДИЕНТЫ МОЛОКА.

Сумма на порцию % Дневная стоимость *
Всего жиров 3 г 5%
Насыщенные жиры 1.5 гр.
Холестрол 10 мг 3%
Натрий 35 мг 2%

7

7

8%
Железо 0%
Калий 2%

* Процент дневной нормы (DV) основан на диете в 2000 калорий.

Комбинация диеты с высоким содержанием жиров и сгущенного молока обостряет воспаление и инсулинорезистентность, индуцированную каждым отдельно у мышей

, 1 , 2 , 2 , 3 , 2 , 1 , 4 , 4 , 4 , 5 , 5 , 2 , 6 , 6 , 1, 2 и 1, 2 Нунес Маси

1 Междисциплинарная программа последипломного образования в области медицинских наук, Крузейро Университета Сул, Сан-Паулу, Бразилия

Аманда Роке Мартинс

2 Кафедра физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Пау , Сан-Паулу, Бразилия

Аманда Рабелло Кризма

2 Кафедра физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Катия Лира-ду-Амарал

3 Кампус точных наук и технологий, Государственный университет Гояс, Анаполис, Бразилия

Мариана Родригес Давансо

2 Кафедра физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Паулу Сан-Паулу, Бразилия

Тамирес Дуарте Афонсу Сердан

1 Междисциплинарная программа последипломного образования в области медицинских наук, Университет Крузейро Сул, Сан-Паулу, Сан-Паулу, Бразилия

Роберта Дорадо Кавальканте-да-Кунья-де-Са

Наук, Институт биомедицинских наук, Федеральный университет Сан-Паулу, Сан-Паулу, Бразилия

Майса Мариана Крус

4 Департамент биологических наук, Институт биомедицинских наук Федерального университета Сан-Паулу, Сан-Паулу, Бразилия

Мария Изабель Кардосо Алонсо-Вале

4 Отделение биологических наук, Институт доктор биомедицинских наук, Федеральный университет Сан-Паулу, Сан-Паулу, Бразилия

Розангела Паван Торрес

5 Кафедра пищевых продуктов и экспериментального питания, Факультет фармацевтических наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Хорхе Манчини -Filho

5 Кафедра пищевых продуктов и экспериментального питания, Факультет фармацевтических наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Джойс Найара Берталья Перейра

2 Кафедра физиологии и биофизики Института биомедицины Университет Сан-Паулу, Сан-Паулу, Бразилия

Марта Мария да Силва Ригетти

6 Кафедра анатомии, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Эдсон Апаресидо Либерти

42 9024 анатомии, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Сандро Массао Хирабара

1 Междисциплинарная программа последипломного образования в области медицинских наук, Крузейро Университета Сул, Сан-Паулу, Бразилия

2 Отделение физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Руи Кури

1 Междисциплинарная программа последипломного образования в области медицинских наук, Крузейро, Университет Сул, Сан-Паулу, Бразилия

2 Кафедра физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу Паулу, Бразилия

1 Междисциплинарная программа последипломного образования в области медицинских наук, Крузейро Университета Сул, Сан-Паулу, Бразилия

2 Департамент физиологии и биофизики, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

3 Кампус точных наук и технологий, Государственный университет Гояс, Анаполис, Бра zil

4 Кафедра биологических наук, Институт биомедицинских наук, Федеральный университет Сан-Паулу, Сан-Паулу, Бразилия

5 Кафедра пищевых продуктов и экспериментального питания, Факультет фармацевтических наук, Университет Сан-Паулу, Сан-Паулу , Бразилия

6 Отделение анатомии, Институт биомедицинских наук, Университет Сан-Паулу, Сан-Паулу, Бразилия

Автор, отвечающий за переписку.

Поступило 7 декабря 2016 г .; Принята в печать 15 мая 2017 г.

Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или любом формате, при условии, что вы должным образом укажете автора (авторов) и источник, укажите ссылку на лицензию Creative Commons и укажите, были ли внесены изменения. Изображения или другие материалы третьих лиц в этой статье включены в лицензию Creative Commons для статьи, если иное не указано в кредитной линии для материала.Если материал не включен в лицензию Creative Commons для статьи и ваше предполагаемое использование не разрешено законом или превышает разрешенное использование, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4.0/. Эта статья цитируется в других статьях PMC.

Abstract

Диеты, вызывающие ожирение, увеличивают массу тела и вызывают инсулинорезистентность (ИР), однако связь этих изменений с основными макроэлементами в рационе еще предстоит выяснить.Самцов мышей C57BL / 6 кормили: контролем (CD), CD и сгущенным молоком (HS), жирным (HF) и HF и сгущенным молоком (HSHF). Через 2 месяца наблюдались увеличение массы тела, непереносимость глюкозы, размер адипоцитов и уровень холестерина. По сравнению с CD, HS потреблял такое же количество калорий, тогда как HF и HSHF потребляли меньше. HS имел повышенную активность AST в плазме и коллаген I типа печени. HF вызывал легкий стеатоз печени и гепатоцеллюлярное повреждение. HF и HSHF увеличивали холестерин ЛПНП, гипертрофию гепатоцитов и адипоцитов, TNF-α макрофагами и снижали липогенез и адипонектин в жировой ткани (AT).HSHF усиливал эти эффекты, увеличивая IR, липолиз, экспрессию мРНК F4 / 80 и лептина в AT, Tlr-4 в камбаловидной мышце и белка IL-6, IL-1β, VCAM-1 и ICAM-1 в AT. Три диеты с ожирением вызвали ожирение и метаболическую дисфункцию. HS был более провоспалительным, чем HF, и индуцировал фиброз печени. HF был более вредным с точки зрения чувствительности к инсулину и вызывал стеатоз печени. Комбинация HSHF усиливала эффекты каждого в отдельности на инсулинорезистентность и воспалительное состояние при АТ.

Введение

Ожирение является независимым фактором высокого риска метаболических заболеваний, таких как диабет 2 типа и неалкогольная жировая болезнь печени. Высокое потребление жира или сахара вызывает ожирение и сопутствующие заболевания, такие как инсулинорезистентность, гипергликемия и дислипидемия у людей и экспериментальных животных 1 , 2 . Мыши, получавшие высокоэнергетическую пищу, используются в качестве экспериментальной модели для исследования механизмов, связанных с дисфункцией метаболизма 3 5 .Несколько исследователей объединили макроэлементы, жир и сахар (фруктозу), чтобы вызвать основные признаки метаболических нарушений, наблюдаемых у людей 6 , 7 . Различные составы высококалорийной пищи могут увеличивать вес и приводить к инсулинорезистентности с разной степенью интенсивности. Майоли и др. . 6 сообщил, что у мышей C57BL / 6, по сравнению с другими диетами с ожирением, которые, как сообщалось, вызывают ожирение или метаболические нарушения, диета, богатая сахарозой и липидами, вызывает более заметное увеличение массы тела и повышение уровня глюкозы в крови натощак. .Авторы сообщили о снижении частоты регуляторных Т-клеток, а также о снижении уровней противовоспалительных цитокинов (TGF-β и IL-10) в жировой ткани 6 . Пациенты с ожирением регулярно придерживаются диеты, богатой сахаром и жирами. Однако еще предстоит выяснить, оказывают ли жир или сахар пагубное влияние на метаболизм. В этом исследовании мы изучили влияние диеты с высоким содержанием жиров, диеты с высоким содержанием сахара и комбинации с высоким содержанием жиров и сахара в рационе на интенсивность воспаления и инсулинорезистентность у мышей C57BL / 6.Мыши, получавшие диету с высоким содержанием сахара, имели свободный доступ к сгущенному молоку с сахаром, содержащему 68% энергии в виде углеводов.

Результаты

Три группы мышей получали пищу с ожирением, различающуюся по составу макроэлементов и общему количеству калорий. Мыши CD служили базой. Высокое количество жиров в рационе снизило потребление калорий на 22% в группе HF и на 14% в группе HSHF. Не было разницы в потреблении калорий в группах HS и CD (таблица). Учитывая общее количество потребляемых калорий и энергетический состав рациона, группы CD и HS потребляли углеводы в качестве основного источника макроэлементов, 536.9 ккал и 541,4 ккал в неделю соответственно. Группа HF потребляла жир в качестве основного источника макроэлементов (325,6 ккал в неделю), а группа HSHF принимала комбинацию жира (297,5 ккал в неделю) и углеводов (228,4 ккал в неделю). Потребление HS и HF по сравнению с CD привело к заметному увеличению массы тела (увеличивается в 4,8 и 5,3 раза соответственно) в течение экспериментального периода. ВЧП привел к более выраженному увеличению (в 9,3 раза) (таблица).

Таблица 1

Масса тела, потребление пищи и уровни метаболитов в сыворотке у мышей, получавших либо контрольную диету, либо диету с ожирением (с высоким содержанием сахара (HS), высоким содержанием жиров (HF) и высоким содержанием сахара / высоким содержанием жира (HSHF) ) в течение восьми недель.

74,8 ± 4,67
CD HS HF HSHF
Исходная масса тела (г) 26,0 ± 0,67 25,0 ± 0,57 25,0 ± 0,57 25,0 ± 0,57
Прирост массы тела (г) 1,9 ± 0,42 9,9 ± 0,98 a 8,9 ± 1,10 a 17,5 ± 1,41 a, b, c
Пища в неделю) 177.2 ± 7,13 130,2 ± 4,86 ​​ a 102,7 ± 1,17 a, b 82,1 ± 1,66 a, b, c
Потребление сгущенного молока (г / неделя) 51,8 ± 6,57 b
Потребление калорий (ккал / неделя) * 673,7 ± 27,01 738,0 ± 15,99 548,5 ± 6,25 6027,8 a, b 24,66 a, b, c
Висцеральная жировая ткань (г) 0.64 ± 0,19 1,3 ± 0,24 a 1,7 ± 0,41 a 2,0 ± 0,26 a, b
Масса печени (г) 1,2 ± 0,04 2 1,8 ± 0,15 2 a ± 0,15 1,8 ± 0,13 а 2,0 ± 0,12 а
Общий холестерин (мг / дл) 137,0 ± 7,42 186,0 ± 5,84
2
2 911 мг глюкозы / дл)
207,0 ± 8,52 a
ЛПНП-холестерин (мг / дл) 85.0 ± 7,30 100,0 ± 4,27 140,0 ± 9,37 a, b 114,0 ± 6,72 a
Триацилглицерин (мг / дл) 62,0 ± 5,90 27,07 911 3,41 9027 62,0 ± 5,90 27,07 911 3,4 4,25 72,0 ± 3,29
АСТ (Ед / л) 13,8 ± 1,25 31,2 ± 4,23 a 18,9 ± 2,39 25,1 ± 4,32
163,0 ± 7.84 190,0 ± 6,83 240,0 ± 13,64 a, b 214,0 ± 13,49 a
инсулин сыворотки натощак ** (нг / мл) 0,3 ± 0,03 1,1 1,2 ± 0,25 2,4 ± 0,45 a, b, c
Непереносимость глюкозы (AUC) 8154 ± 840,6 14209 ± 1305 a 14409 ± 1372 a

14409 ± 1372

9

a
Чувствительность к инсулину (kITT -% / мин) 3.5 ± 0,25 3,1 ± 0,20 3,7 ± 0,28 2,2 ± 0,21 a, b, c

По сравнению с CD, диеты с ожирением (HS, HF и HSHF) вызывали последовательное увеличение вес висцеральной жировой ткани (брыжеечной, эпидидимальной и периренальной) в 2, 2,7 и 3 раза соответственно, сырой массы печени на 50%, 50% и 67%, соответственно, а также интенсивность непереносимости глюкозы (на что указывает область под кривая) на 70%, 80% и 130% соответственно (рис.и таблица).

Вариации уровня глюкозы в крови во время ( A ) теста толерантности к глюкозе (GTT) и ( B ) теста толерантности к инсулину (ITT) у мышей, получавших контрольную диету (CD) или диету с ожирением (с высоким содержанием сахара (HS ), с высоким содержанием жиров (HF) или с высоким содержанием сахара / жира (HSHF) в течение 8 недель. Результаты выражаются как среднее значение ± SEM (n = 4–7 / группа).

Высокое количество жира в рационе (HF и HSHF) вызывали повышение сывороточных уровней холестерина ЛПНП на 65% и 34% соответственно, а при гликемии на 47% и 31% соответственно по сравнению с животными CD (таблица).Высокое количество сахара в рационе (HS) увеличивало активность AST в 2,3 раза по сравнению с CD (таблица). Комбинация с высоким содержанием сахара и с высоким содержанием жира (группа HSHF) снизила чувствительность к инсулину (по данным kITT) на 29% и 40% соответственно, увеличила массу тела на 77% и 97%, соответственно, и уровень инсулина в сыворотке крови натощак через 6 часов. уровни в 2 раза по сравнению с группами HS и HF соответственно (рис. и таблица).

Размер подкожных адипоцитов увеличивался за счет трех диет с ожирением (HS на 10%; HF на 19%; HSHF на 24%) по сравнению с диетой CD (рис.). Группы HF и HSHF увеличивали размер адипоцитов на 8,5% и 13% соответственно по сравнению с группой HS (рис.).

Размер паховых адипоцитов ( A ), скорость липолиза ( B ) и липогенеза ( C ) у мышей, получавших контрольную диету (CD) или диету с ожирением (с высоким содержанием сахара (HS) и высоким содержанием жира (HF)). ) и диета с высоким содержанием сахара / жира (HSHF) в течение 8 недель. Результаты выражены как среднее значение ± SEM (n = 4–7 / группа). (a) P <0,05 по сравнению с CD, (b ) P <0.05 по сравнению с HS, и (c) P <0,05 по сравнению с HF, с использованием однофакторного дисперсионного анализа и пост-теста Тьюки.

Комбинация сахара и жира (HSHF) привела к заметному увеличению массы тела. Это была единственная группа, которая показала усиление липолиза в ткани инкубированных подкожных адипоцитов как в нестимулированных (в 7,8 раза по сравнению с CD; в 2,6 раза по сравнению с HS и в 2,3 раза по сравнению с HF), так и в условиях, стимулированных изопротеренолом ( в 2 раза по сравнению со всеми остальными) (рис.). Высокое содержание жира в рационе (в группах HF и HSHF) снижало липогенез в стимулированных инсулином подкожных адипоцитах в 2 и 2,4 раза соответственно по сравнению с мышами HS и HF, тогда как по сравнению с мышами HS и HF липогенез снижался в 2 раза. с мышами CD (рис.).

Диета с высоким содержанием сахара (группа HS) увеличивала отложение коллагена типа I в печени, что продемонстрировано качественным анализом с использованием окрашивания пикросириусом красным по сравнению с другими (рис.). В печени мышей, получавших пищу с высоким содержанием жиров, были большие липидные капли, на что указывало окрашивание Суданом (рис.). Диета, вызывающая ожирение, также вызывала гибель клеток, о чем свидетельствует снижение плотности окрашивания ядер гематоксилином и эозином (HS на 18%; HF на 16,5% и HSHF на 24,5% по сравнению с CD) (рис.) И приводило к увеличению в области гепатоцитов (HS в 1,7 раза; HF в 2 раза и HSHF в 2,5 раза по сравнению с CD) (рис.).

Микрофотографии, иллюстрирующие морфологию печени мышей, получавших контрольную диету или диету с ожирением (диета с высоким содержанием сахара (HS), с высоким содержанием жиров (HF) или диета с высоким содержанием сахара / высоким содержанием жира (HSHF) в течение 8 недель.( A ) окрашивание пикросириусом красным; bar = 20 мкм; ( B ) Суданское черное окрашивание; bar = 10 мкм; ( C ) окраска гематоксилином и эозином; bar = 20 мкм; ( D ) азокармин; bar = 20 мкм; ( E ) ядерная плотность (ядер / мм 2 ) с использованием 5 случайных полей / 3 срезов / животное; и ( F ) площадь гепатоцитов ( 2 мкм), измеренная в 45 клетках на животное. Результаты выражены в виде среднего значения ± S.E.M. (n = 4–7 / группа). (а) P <0.05 по сравнению с CD, (b) P, <0,05 по сравнению с HS и (c) P, <0,05 по сравнению с HF, с использованием однофакторного дисперсионного анализа и пост-теста Тьюки.

Поставка сгущенного молока (группа HS) увеличивала экспрессию мРНК лептина в еАТ (в 3,3 раза) и коллагена типа I (в 2 раза) в печени и снижала экспрессию мРНК лептина ( в 3,6 раза) в камбаловидной мышце (таблица) по сравнению с группой CD. Мыши HF показали повышенную экспрессию мРНК лептина (на 3.В 5 раз) и снижение экспрессии адипонектина (в 2,8 раза) в eAT по сравнению с группой CD (таблица). Комбинация сахара и жира (группа HSHF) увеличивала экспрессию мРНК F4 / 80 (в 5,7 раза) и снижала экспрессию адипонектина (в 2,8 раза) в eAT и увеличивала Tlr 4 экспрессии мРНК (в 1,6 раза) в камбаловидной мышце по сравнению с группой CD (таблица).

Таблица 2

Экспрессия мРНК

воспалительных генов в инсулино-чувствительных тканях: жировая ткань, печень и скелетные мышцы мышей, получавших контрольную диету (2) или диету с ожирением: с высоким содержанием сахара (HS), с высоким содержанием жира (HF) и диета с высоким содержанием сахара / жира (HSHF) в течение восьми недель.

Ткань мРНК CD HS HF HSHF
eAT F4 / 80 1 ± 0,09 2,5 ± 0,36 4,5 ± 0,81 5,7 ± 1,42 а
Адипонектин 1,4 ± 0,21 1,1 ± 0,28 0,5 ± 0,10 а 0,5 ± 0,18 а
Лептин 1.2 ± 0,15 3,9 ± 0,40 a 3,0 ± 0,37 a 2,4 ± 0,35 b
Печень Коллаген 1,1 ± 0,23 2,2 ± 0,37 а 1,3 ± 0,28 1,6 ± 0,17
Tnf α 1,5 ± 0,41 2,9 ± 0,87 c 0,7 ± 0,14 1,1 ± 0,27
Soleus Muscle Лептин 1.1 ± 0,25 0,3 ± 0,07 а, в 1,4 ± 0,17 1,1 ± 0,26
Tlr4 1,0 ± 0,11 1,3 ± 0,13 1 ± 0,13 1,6 ± 0,09 a, c

Только комбинированная диета с высоким содержанием сахара и жира (группа HSHF) вызвала значительное увеличение продукция провоспалительного белка в жировой ткани придатка яичка по сравнению с тремя другими группами: IL-6 (на 2.В 6 раз по сравнению с CD; в 1,5 раза по сравнению с HS; в 1,9 раза по сравнению с HF), IL1-β (в 2,9 раза по сравнению с CD; в 2 раза по сравнению с HS и HF), лептин (в 14,5 раза по сравнению с CD; в 3 раза по сравнению с HS; в 5 раз по сравнению с HF), VCAM-1 (в 2,4 раза по сравнению с CD; в 2,3 раза по сравнению с HF) и ICAM-1 (в 2,6 раза по сравнению с CD) (рис., соответственно).

Содержание IL-6 ( A ), IL-1β ( B ), лептина ( C ), VCAM-1 ( D ) и ICAM-1 ( E ) в жировой ткани придатка яичка и IL-6 ( F ), TNF-α ( G ) и оксида азота ( H ) стимулированными LPS перитонеальными макрофагами (1 × 10 6 клеток) от мышей C57BL / 6, получавших контроль диета (CD) или диета, способствующая ожирению (диета с высоким содержанием сахара (HS), высоким содержанием жиров (HF) или диета с высоким содержанием сахара / жира (HSHF) в течение восьми недель).Результаты выражены в виде среднего значения ± S.E.M. (n = 4–7 / группа). (a) P <0,05 по сравнению с CD, (b) P <0,05 по сравнению с HS, и (c) P <0,05 по сравнению с HF, с использованием однофакторного дисперсионного анализа ANOVA и пост-теста Тьюки. VCAM, белок адгезии сосудистых клеток 1; ICAM, молекула межклеточной адгезии клеток 1; ИЛ, интерлейкин; ЛПС, липополисахарид из E . coli 055: B5 (2,5 мкг / мл в течение 24 ч).

Стимулированные LPS перитонеальные макрофаги продемонстрировали поразительное (в 28 раз) увеличение продукции IL-6 у мышей, получавших диету HS, по сравнению с диетой CD (рис.). Диеты HF и HSHF вызывали 8-кратное увеличение продукции TNF-α по сравнению с диетой CD (рис.), И только диета HF увеличивала продукцию оксида азота (в 6,2 раза) по сравнению с перитонеальными макрофагами мышей CD ( Инжир. ).

Обсуждение

Высококалорийные диеты вызывают ожирение и сопутствующие заболевания, такие как инсулинорезистентность, неалкогольная жировая болезнь печени (НАЖБП) и хроническое воспаление средней степени тяжести 8 11 . Эти диеты содержат большое количество сахара, жира или того и другого.Целью этого исследования было выяснить, может ли заметное увеличение одного из макроэлементов, жира или сахара, или обоих, повлиять на последствия ожирения для воспаления и инсулинорезистентности. Мышей кормили одним из трех режимов диеты с ожирением: контрольная диета со свободным доступом к сгущенному молоку с сахаром, диета с высоким содержанием жиров или диета с высоким содержанием жиров со свободным доступом к сгущенному молоку с сахаром. Основным макроэлементом, присутствующим в используемом сгущенном молоке с сахаром и который обычно имеется в продаже на рынке, являются углеводы (~ 53% сахарозы и ~ 15% лактозы) 12 .Три диеты с ожирением вызывали увеличение массы тела, непереносимость глюкозы и увеличение депо висцерального жира и сырой массы печени, размера адипоцитов и уровней общего холестерина в сыворотке по сравнению с контрольной диетой. Эти изменения были более выражены в группе диеты с высоким содержанием сахара / жира и характеризуют состояние метаболического синдрома.

Мыши с высоким содержанием жиров и высоким содержанием сахара / жира потребляли меньше калорий, тогда как группа с высоким содержанием сахара потребляла столько же калорий, что и контрольная группа.Все согласны с тем, что более высокое потребление калорий вызывает более высокий прирост массы тела независимо от источника 13 . Чрезмерное потребление быстро усваиваемых углеводов и вкусной пищи, такой как сгущенное молоко, вызывает быстрое повышение уровня инсулина в сыворотке крови, и тогда возникает тяга к пище 14 , 15 . Холл 16 описал углеводно-инсулиновую модель, в которой диеты с высокой долей углеводов повышают секрецию инсулина, тем самым подавляя высвобождение жирных кислот из жировой ткани в кровоток и направляя циркулирующие жирные кислоты в хранилище жировой ткани. и вдали от окисления метаболически активными тканями, такими как сердце, мышцы и печень.Это изменение наличия и распределения топлива может привести к состоянию «внутреннего голодания» клетки, снижению расхода энергии и усилению голода 17 .

Жир является самым калорийным компонентом рациона (9 ккал / г по сравнению с 4 ккал / г для углеводов) 18 , но он подавляет аппетит 19 . Недавно Olsen и др. . 20 сообщили, что у старых мышей-самцов C57BL / 6 J, получавших диету с высоким содержанием жиров (60% жира) в течение пяти недель, масса тела увеличилась, но через 6 недель после начала кормления с помощью диеты с высоким содержанием жиров (в возрасте 11 недель) наблюдалась стабилизация. ).Авторы также сообщили об отсутствии разницы в потреблении калорий между HF и контрольной мышами ни во время светлой фазы, ни во время темной фазы. Измеряли расход энергии, и скорость основного метаболизма оставалась неизменной у мышей с ожирением по сравнению с контрольной группой, получавшей сбалансированную пищу. У мышей с ожирением, по-видимому, значительно снизился уровень активного метаболизма. Кроме того, исследования термогенеза, вызванного диетой, показали, что меньше энергии рассеивается в виде тепла после переваривания жира (~ 7%) по сравнению с сахарозой (~ 11%).4%) 21 .

Свободный доступ к сгущенному молоку вызывал повышение сывороточной активности AST и отложения коллагена I типа в печени, что продемонстрировано морфологическим анализом и подтверждено экспрессией мРНК. Сгущенное молоко содержит около 53% сахарозы, дисахарида, содержащего глюкозу и фруктозу. У людей повышенное потребление фруктозы связано с повышенной тяжестью стеатоза и фиброза печени 22 , 23 .Прием сахарозы, содержащей фруктозу, скорее всего, ускоряет развитие фиброгенеза печени 24 , 25 . Высокое потребление сахара также способствует воспалению, о чем свидетельствует увеличенная продукция IL-6 перитонеальными макрофагами и экспрессия мРНК Tnf α в печени. Некоторые авторы также описали связь между устойчивостью к лептину и развитием неалкогольного стеатогепатита (НАСГ) 26 28 .

НАЖБП относится к спектру заболеваний печени, включая неалкогольную жировую болезнь печени, которая характеризуется стеатозом без воспаления или незначительным воспалением, и НАСГ, который связан с воспалением и вздутием живота с фиброзом или без него 29 , и он может прогрессировать до цирроза печени и гепатоцеллюлярной карциномы 30 , 31 . Как сообщалось в этом исследовании и в работах других авторов, в печени мышей, получавших диету с высоким содержанием жиров, отсутствовал фиброз и наблюдался легкий стеатоз и очаговый гепатоцеллюлярный некроз и апоптоз; их особенности были совместимы с прогрессированием стеатоза при НАСГ 32 .Повышенная продукция окиси азота перитонеальными макрофагами, вызванная диетой с высоким содержанием жиров, описанная в этом исследовании, может способствовать развитию НАСГ. NO участвует в прогрессировании НАСГ, включая митохондриальную дисфункцию 33 и биогенез 34 .

Замена диеты с высоким содержанием жиров диете с высоким содержанием углеводов связана с уменьшением размера частиц ЛПНП и увеличением плотности ЛПНП, что способствует атерогенной дислипидемии 35 , 36 .Диета с высоким содержанием жиров увеличивала плазменные уровни холестерина ЛПНП, гликемию, продукцию TNF-α перитонеальными макрофагами, приводила к гипертрофии гепатоцитов и адипоцитов, а также к снижению липогенеза и содержания адипонектина в жировой ткани, независимо от включения сгущенного молока. Это наблюдение указывает на серьезную метаболическую дисфункцию, вызванную жировой диетой. Гипертрофия адипоцитов и гепатоцитов и воспалительные реакции связаны с развитием инсулинорезистентности и, как следствие, увеличением гликемии 37 .Адипонектин увеличивает β-окисление жирных кислот 38 и часто ниже в плазме тучных субъектов 39 . Лю и др. . 40 сообщили, что перитонеальные макрофаги от мышей с ожирением, вызванным диетой, демонстрируют нарушение аутофагии с повышенным продуцированием TNF-α. Липогенез стимулируется высоким потреблением пищи, что способствует накоплению триглицеридов 41 . Brunengraber и др. . 42 сообщили о снижении липогенеза жировых подушечек придатка яичка у мышей, потребляющих диету с высоким содержанием жиров на основе сала по сравнению с диетой с высоким содержанием углеводов.

Диета с высоким содержанием сахара / жира усиливала эффекты, вызванные двумя диетами, вызывающими ожирение по отдельности, что приводило к повышению уровня инсулина в сыворотке крови натощак, инсулинорезистентности, липолизу, экспрессии мРНК F4 / 80 и лептина в жировая ткань, экспрессия мРНК Tlr 4 в камбаловидной мышце и содержание белка IL-6, IL-1β, лептина, VCAM-1 и ICAM-1 в жировой ткани (рис.). Группа HSHF потребляла столько же калорий, сколько и контрольная группа.Ожирение и связанные с ним сопутствующие заболевания усугублялись сочетанием того и другого. Майоли и др. . 6 сообщил, что мыши, получавшие диету с высоким содержанием сахара и масла в течение 11 недель, демонстрировали, как продемонстрировано в нашем исследовании, изменения, совместимые с метаболическим синдромом и более интенсивным воспалением по сравнению с мышами, получавшими пищу, диету AIN93G, диету с высоким содержанием сахара. или диета с высоким содержанием жиров.

Краткое изложение эффектов трех диет с высоким содержанием сахара (HS), с высоким содержанием жира (HF) и с высоким содержанием сахара / жира (HSHF), назначенных мышам в течение восьми недель.Стрелки вверх указывают на увеличение, а стрелки вниз указывают на уменьшение. Описания эффектов были разделены на общие общие признаки, воспалительное состояние, состояние инсулинорезистентности (ИР) и изменения в крови. AST, аспартатаминотрансфераза; VCAM, белок адгезии сосудистых клеток 1; ICAM, молекула межклеточной адгезии клеток 1; ИЛ, интерлейкин; TNF, некроз опухоли альфа; Tlr-4, толл-подобный рецептор 4; ИР, инсулинорезистентность.

Животные модели питания были разработаны для имитации пищевых привычек, которые приводят к ожирению и связанным с ним расстройствам, таким как НАЖБП у людей.Сгущенное молоко было более воспалительным, чем диета с высоким содержанием жиров, и вызывало фиброз печени. Диета с высоким содержанием жиров была более пагубной для периферической чувствительности к инсулину и вызывала стеатоз печени. Прием комбинации диеты с высоким содержанием сахара и жира усиливал все изменения, вызванные диетами с высоким содержанием сахара и высоким содержанием жиров по отдельности. Краткое изложение полученных результатов представлено на рис.

Материалы и методы

Этическое разрешение

Исследования на животных проводились в соответствии с протоколами, утвержденными Комитетом по уходу за животными Института биомедицинских наук Университета Сан-Паулу, Сан-Паулу, Бразилия (125/10 / CEUA).Все эксперименты проводились в соответствии с соответствующими инструкциями и правилами.

Животные

Самцов мышей C57BL / 6 (возраст 12 недель) содержали в комнате с циклом свет-темнота 12–12 часов и температурой 23 ± 2 ° C. Мыши были разделены на две группы и получали контрольную диету (CD) (энергетический состав 76% углеводов, 9% жира, 15% белков; 3,8 ккал / г) или диету с высоким содержанием жиров (HF) (энергетический состав 26% углеводов, 59% жиров, 15% белков; 5,3 Ккал / г) в течение 8 недель.В обеих диетах основным источником жира было сало, а основным источником углеводов — кукурузный крахмал. Аналогичный протокол применялся в наших предыдущих исследованиях 43 46 . Примерно 50% мышей CD и HF одновременно с диетой получали отдельную миску сгущенного молока с сахаром (энергетический состав: 68% углеводов, 23% жира, 9% белка; 3,25 ккал / г) (Italac, Sao Paulo, SP, Бразилия) с добавлением смеси витаминов и минералов (Rhoster, Sao Paulo, SP, Brazil) для получения двух других групп: с высоким содержанием сахара (HS) и с высоким содержанием жира и высоким содержанием сахара (HFHS) 47 .Сгущенное молоко, вода и обе диеты (CD и HF) были предоставлены ad libitum . Мышей взвешивали один раз в неделю. Потребление пищи и сгущенного молока измеряли и выдавали повторно каждые 2 дня. Были рассчитаны потребление пищи ([предложенная пища (г) — оставшаяся пища (г)]), сгущенное молоко и потребление калорий ([потребление пищи × ккал / г рациона] + [потребление сгущенного молока × ккал / г сгущенного молока]) для каждой группы каждую неделю в клетке, состоящей из 6 мышей. После 8 недель диеты, вызывающей ожирение (возраст 20 недель), мышей не кормили в течение 2–4 часов, а затем умерщвляли с помощью диоксида углерода.

Измерения крови, тесты толерантности к глюкозе и инсулину

Измерения крови, тесты толерантности к глюкозе (GTT) и тесты толерантности к инсулину (ITT) были выполнены, как описано в нашем предыдущем исследовании 46 . Константа скорости для ITT (kITT) была рассчитана по формуле kITT (% / мин) = 0,693 / t½, где t½ рассчитывается по наклону концентрации глюкозы в плазме в течение периода от 0 до 20 минут после инъекции инсулина с использованием анализ методом наименьших квадратов; снижение концентрации глюкозы в плазме в этот период было линейным.Общий холестерин 48 , триацилглицерин 49 и активность аспартатаминотрансферазы-AST 50 были оценены с помощью колориметрических анализов (был определен инсулин Labtest ELIS, Lagoa Santa, MG, Бразилия). (Комплект Millipore, Сент-Чарльз, Миссури). Холестерин ЛПНП рассчитывали с использованием уравнения Фридевальда 51 .

Выделение адипоцитов и метаболизм жировой ткани

Подкожное выделение адипоцитов выполняли, как описано ранее 52 с небольшими изменениями 53 .Небольшое количество адипоцитов фотографировали с помощью оптического микроскопа (увеличение × 100) и камеры микроскопа (Moticam 1000; Motic, Ричмонд, Британская Колумбия, Канада), и средний диаметр адипоцитов оценивали путем измерения 50 клеток с помощью Motic-Images Plus. 2.0 программное обеспечение. Липолиз и включение [1- 14 C] -ацетата в жирные кислоты оценивали в подкожных адипоцитах, выделенных, как описано в предыдущих исследованиях 44 , 53 .

Измерение маркеров воспаления

Параметры воспаления измеряли в придатковой жировой ткани (eAT) [интерлейкин (IL) -6, IL-1β, лептин, молекула сосудистой адгезии-1 (VCAM-1) и молекула межклеточной адгезии 1 (ICAM-1)] и перитонеальных макрофагов (IL-6 и фактор некроза опухоли α — TNF-α) с помощью ELISA (наборы DuoSet, R&D System, MN, США).Значения, полученные для эпидидимальной жировой ткани, были нормализованы к общему содержанию белка с применением метода Брэдфорда 54 . Для придатковой жировой ткани общий вес ткани также использовался для нормализации. Производство оксида азота (NO) перитонеальными макрофагами определяли с использованием метода Грисса 55 , описанного в нашем предыдущем исследовании 47 .

Анализ экспрессии генов

Уровни экспрессии генов, участвующих в воспалении в eAT, печени и камбаловидной мышце, оценивали с помощью ПЦР в реальном времени (полимеразная цепная реакция), как ранее сообщала наша группа 43 .Экспрессию Rplp0 использовали в качестве внутреннего контроля для eAT и экспрессию 18S для печени и камбаловидной мышцы. Эталонные гены были определены в предварительных анализах, которые показали неизменные уровни экспрессии в использованных здесь экспериментальных условиях 56 , 57 . Последовательности праймеров были: F4 / 80 , {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_010130.4», «term_id»: «183583543»}} NM_010130. 4, смысл CCTGAACATGCAACCTGCCAC, антисмысловой GGGCAT GAGCAGBCTGTAGGATC, Адипонектин , NM_009605.4, смысл TCTTAATCCTGCCCAGTCATGC, антисмысловой TCCAACATCTCCTGTCTCACCC, Лептин , {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_008493.3», «term_id»: «34328437» }.3 NM_00_00 , смысл TCACACACGCAGTCGGTATCC, антисмысловой ATGGAGGAGGTCTCGGAGATT, Коллаген , {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NM_009931.2», «term_id»: «161484653»}}, NM_009931 смысловой CTCTATGTCCAAGGCAACGAG, антисмысловой TCACAAACCGCACACCTG, TNF α , {«тип»: «энтрез-нуклеотид», «attrs»: {«текст»: «NM_001278601.1 «,» term_id «:» 518831588 «}} NM_001278601.1, смысл TCTTCTCATTCCTGCTTGTGGC, антисмысловой CACTTGGTGGTTTGCTACGAC G, Tlr4 , {» type «:» entrez_ «нуклеотид», «text attrs1297″: » 3 «,» term_id «:» 927442692 «}} NM_021297.3, sense TTCAGAACTTCAGTGGCTGG, антисмысловой TGTTAGTCCAGAGAAACTTCCTG, Rplp0 , {» type «:» entrez-nucleotide «,» attrs «: {» text «: «,» term_id «:» 254939638 «}} NM_007475.5, смысл CCACTTACTGAAAAGGTCAAGGC, антисмысловой TGGTTGCTTTGGCGGGATTA, 18S , NM_030720.1, смысл CGCTACACTGACTGGCTCAG и антисмысловой CAGGACTGACTGGCTCAG.

Гистоморфометрический анализ печени

Собирали фрагменты правой доли печени, фиксировали в 10% параформальдегиде в течение 24 часов и промывали в дистиллированной воде в течение 6 часов для световой микроскопии. После фиксации фрагментов печени материал обезвоживали в серии восходящего спирта, диафанизировали в ксилоле и заливали парафином. Полусерийные гистологические срезы толщиной 5 мкм окрашивали пикросириусом красным 58 в поляризованном свете для обнаружения коллагеновых волокон типов I и III и суданом черным для обнаружения липидов.Изображения гепатоцитов (площадь и плотность) получали с помощью камеры (AxioCam), соединенной с тринокулярным микроскопом (Zeiss, Оберкохен, Германия), и анализировали с помощью программного обеспечения для анализа изображений Axio Vision 4.3. Для определения площади гепатоцитов ( 2 мкм) произвольно измеряли окрашенные азокармином срезы (45 клеток на животное). Ядерная плотность (ядро / мм 2 ) рассчитывалась с использованием 5 случайных полей / 3 срезов / животное, окрашенных гематоксилином и эозином 59 .

Статистический анализ

Результаты представлены как среднее ± стандартная ошибка среднего (S.E.M.). Все группы сравнивали друг с другом с использованием однофакторного дисперсионного анализа и пост-теста Тьюки (GraphPad Prism, версия 5.01). Различия считались статистически значимыми при P <0,05.

Благодарности

Авторы признательны доктору Татьяне Каролине Альба-Лоурейро, доктору Гилсону Мурате и Хосе Роберто Мендонсе за их техническую помощь.Авторы являются стипендиатами CAPES, CNPq, FAPESP и Фонда Гуггенхайма. Авторы являются стипендиатами и финансовой поддержкой следующих агентств: CAPES (RC), CNPq (RC), FAPESP (LNM, AC, AR, CLA, MRD, TS, RDCCS, MMC, MICAV, RPT, JMF, JNBP, MMSR, EAL, SMH, RC) и Фонд Гуггенхайма (RC).

Вклад авторов

Дизайн исследования: Лауреан Нунес Маси, Руи Кури. Сбор результатов: Лауреан Нуньес Мази, Аманда Роке Мартинс, Аманда Рабелло Кризма, Катия Лира ду Амарал, Мариана Родригес Давансо, Роберта Дорадо Кавальканте да Кунья де Са, Майса Мариана Крус, Марта Мария да Силва Ригетти, Розангела Паван Торрес.Интерпретация результатов: Лауреан Нуньес Маси, Тамирес Дуарте Афонсу Сердан, Джойс Найара Берталья Перейра, Руи Кури. Написание рукописи: Лауреан Нунес Маси, Руи Кури. Кураторы: Мария Изабель Кардосо Алонсо-Вале, Хорхе Манчини-Филью, Эдсон Апаресидо Либерти, Сандро Массао Хирабара, Руи Кури. Все авторы одобрили окончательную версию рукописи для публикации и приняли на себя ответственность за все аспекты работы и за авторство.

Примечания

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересов.

Сноски

Примечание издателя: Springer Nature сохраняет нейтралитет в отношении юрисдикционных претензий на опубликованных картах и ​​принадлежностей организаций.

Ссылки

1. Badoud F, et al. Метаболомика показывает, что метаболически здоровые и нездоровые люди с ожирением различаются по своей реакции на калорийную нагрузку. PLoS One. 2015; 10: e0134613. DOI: 10.1371 / journal.pone.0134613. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 2. Fleur SEla и др.Свобода выбора диеты с высоким содержанием жиров и сахара вызывает непереносимость глюкозы и невосприимчивость к инсулину на нагрузку глюкозой, которая не объясняется ожирением. Int. J. Obes. (Лонд.). 2011; 35: 595–604. DOI: 10.1038 / ijo.2010.164. [PubMed] [CrossRef] [Google Scholar] 3. Чой Дж. И др. Метаболический ответ на диету с высоким содержанием жиров выявляет склонные к ожирению и устойчивые к ожирению фенотипы у мышей с различными профилями транскриптома mRNA-seq. Int. J. Obes. (Лонд.). 2016; 40: 1542–1560. DOI: 10.1038 / ijo.2016.70. [PubMed] [CrossRef] [Google Scholar] 4.Докас Дж., Чадт А., Джуст Х., Аль-Хасани Х. Делеция Tbc1d1 подавляет ожирение у мышей с дефицитом лептина. Int. J. Obes. (Лонд.). 2016; 40: 1242–1249. DOI: 10.1038 / ijo.2016.45. [PubMed] [CrossRef] [Google Scholar] 5. Чжан Дж. И др. Вызванный диетическим ожирением Egr-1 в адипоцитах способствует накоплению энергии за счет подавления FOXC2. Sci. Отчет 2013; 3: 1–10. [Бесплатная статья PMC] [PubMed] [Google Scholar] 6. Майоли Т.Ю. и соавт. Диета с высоким содержанием сахара и масла (HSB) вызывает ожирение и метаболический синдром с уменьшением регуляторных Т-клеток в жировой ткани мышей.Воспаление. Res. 2016; 65: 169–178. DOI: 10.1007 / s00011-015-0902-1. [PubMed] [CrossRef] [Google Scholar] 7. Тиллман Э., Морган Д., Рахмуни К., Своп С. Три месяца кормления с высоким содержанием фруктозы не приводят к чрезмерному увеличению веса или устойчивости к лептину у мышей. PLoS One. 2014; 9: e107206. DOI: 10.1371 / journal.pone.0107206. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 9. Луо Y и др. Метаболический фенотип, особенности жировой ткани и печени на мышиной модели НАЖБП, связанной с ожирением, с высоким содержанием жиров.Являюсь. J. Physiol. Эндокринол. Метаб. 2015; 310: 418–439. DOI: 10.1152 / ajpendo.00319.2015. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Виноло М. и др. Трибутирин ослабляет воспаление, связанное с ожирением, и резистентность к инсулину у мышей, получавших пищу с высоким содержанием жира. Являюсь. J. Physiol. Эндокринол. Метаб. 2012; 303: 272–282. DOI: 10.1152 / ajpendo.00053.2012. [PubMed] [CrossRef] [Google Scholar] 11. Чжан М., Ху Т., Чжан С., Чжоу Л. Связи различных депо жировой ткани с инсулинорезистентностью: систематический обзор и метаанализ наблюдательных исследований.Sci. Отчет 2015; 21: 1–6. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Берч Г.Г., Мвангелва ОМ. Колориметрическое определение сахара в сгущенных молочных продуктах с сахаром. J. Sci. Продовольственное сельское хозяйство. 1974; 25: 1355–1362. DOI: 10.1002 / jsfa.2740251103. [PubMed] [CrossRef] [Google Scholar] 13. Мартинес Дж. А., Навас-Карретеро С., Сарис У. С., Аструп А. Персонализированные стратегии потери веса — роль распределения макроэлементов. Nat. Rev. Endocrinol. 2014; 10: 749–760. DOI: 10.1038 / nrendo.2014.175. [PubMed] [CrossRef] [Google Scholar] 14.Левин Б.Е., Данн-Мейнелл А.А. Защита веса тела зависит от состава рациона и вкусовых качеств крыс с ожирением, вызванным диетой. Являюсь. J. Physiol. 2002. 282: 46–54. [PubMed] [Google Scholar] 15. Муойо DM, Ньюгард CB. Нарушения метаболической регуляции, связанные с ожирением. Анну. Rev. Biochem. 2006; 75: 367–401. DOI: 10.1146 / annurev.biochem.75.103004.142512. [PubMed] [CrossRef] [Google Scholar] 16. Холл, К. Д. Обзор углеводно-инсулиновой модели ожирения. евро . Дж . Клин . Нутрит . 1–4 (2017). [PubMed] 17. Людвиг Д.С., Фридман М.И. Увеличение ожирения: следствие или причина переедания? ДЖАМА. 2014; 311: 2167–2168. DOI: 10.1001 / jama.2014.4133. [PubMed] [CrossRef] [Google Scholar] 18. Уиддоусон Э.М. Оценка энергетической ценности продуктов питания человека. Proc. Nutr. Soc. 1955; 14: 142–154. DOI: 10.1079 / PNS19550031. [PubMed] [CrossRef] [Google Scholar] 19. Wansink B, Shimizu M, Brumberg A. Связь сочетаний богатых питательными веществами закусок с потреблением калорий и овощей.Педиатр. Res. 2013; 131: 22–29. [PubMed] [Google Scholar] 20. Olsen MK, et al. Устойчивый энергетический баланс на животных моделях ожирения и потери веса. Сканд. J. Gatroenterol. 2017; 52: 442–449. DOI: 10.1080 / 00365521.2016.1267791. [PubMed] [CrossRef] [Google Scholar] 21. Blaak EE, Saris WH. Постпрандиальный термогенез и использование субстрата после приема различных пищевых углеводов. Обмен веществ. 1996; 45: 1235–1242. DOI: 10.1016 / S0026-0495 (96)

-3. [PubMed] [CrossRef] [Google Scholar] 22. Абдельмалек М.Ф. и соавт.Повышенное потребление фруктозы связано с серьезностью фиброза у пациентов с неалкогольной жировой болезнью печени. Гепатология. 2010; 51: 1961–1971. DOI: 10.1002 / hep.23535. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Басараноглу М., Басараноглу Г., Бугианеси Э. Потребление углеводов и неалкогольная жировая болезнь печени: фруктоза как оружие массового поражения. Гепатобилиарная хирургия. Nutr. 2015; 4: 109–116. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Ишимото Т. и др. Диета с высоким содержанием жиров и сахарозы (западная) вызывает стеатогепатит, который зависит от фруктокиназы.Гепатология. 2013; 58: 1632–1643. DOI: 10.1002 / hep.26594. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 26. Хигучи Т., Сираи Н., Сайто М., Судзуки Х., Кагава Ю. Уровни плазменного инсулина, лептина и адипонектина и активности ключевых ферментов углеводного обмена в скелетных мышцах и печени у голодных мышей ICR, получавших диетические полиненасыщенные жирные кислоты n-3. J. Nutr. Biochem. 2008; 19: 577–586. DOI: 10.1016 / j.jnutbio.2007.08.001. [PubMed] [CrossRef] [Google Scholar] 27. Хуанг XD и др. Лептин сыворотки и растворимый рецептор лептина при неалкогольной жировой болезни печени.Мир J. Gastroenterol. 2008; 14: 2888–2893. DOI: 10.3748 / wjg.14.2888. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28. Нобили В и др. Лептин, индекс свободного лептина, инсулинорезистентность и фиброз печени у детей с неалкогольной жировой болезнью печени. Евро. J. Endocrinol. 2006; 155: 735–743. DOI: 10.1530 / eje.1.02288. [PubMed] [CrossRef] [Google Scholar] 29. Brown GT, Kleiner DE. Гистопатология неалкогольной жировой болезни печени и неалкогольного стеатогепатита. Обмен веществ. 2016; 65: 1080–1086.DOI: 10.1016 / j.metabol.2015.11.008. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Карагозян Р., Дердак З., Баффи Г. Механизмы гепатоканцерогенеза, связанные с ожирением. Обмен веществ. 2014; 63: 607–617. DOI: 10.1016 / j.metabol.2014.01.011. [PubMed] [CrossRef] [Google Scholar] 31. Starley BQ, Calcagno CJ, Harrison SA. Безалкогольная жировая болезнь печени и гепатоцеллюлярная карцинома: важная связь. Гепатология. 2010. 51: 1820–1832. DOI: 10.1002 / hep.23594. [PubMed] [CrossRef] [Google Scholar] 32.Хеббард Л., Джордж Дж. Животные модели неалкогольной жировой болезни печени. Nat. Преподобный Гастроэнтерол. Гепатол. 2011; 8: 35–44. DOI: 10.1038 / nrgastro.2010.191. [PubMed] [CrossRef] [Google Scholar] 33. Браун GC. Оксид азота регулирует митохондриальное дыхание и функции клеток, ингибируя цитохромоксидазу. Письма FEBS. 1995; 369: 136–139. DOI: 10.1016 / 0014-5793 (95) 00763-Y. [PubMed] [CrossRef] [Google Scholar] 34. Nisoli E, et al. Биогенез митохондрий у млекопитающих: роль эндогенного оксида азота.Наука. 2003; 299: 896–899. DOI: 10.1126 / science.1079368. [PubMed] [CrossRef] [Google Scholar] 35. Гербер П.А., Бернейс К. Регулирование субфракций липопротеинов низкой плотности углеводами. Curr. Opin. Clin. Nutr. Метаб. Забота. 2012; 15: 381–385. DOI: 10.1097 / MCO.0b013e3283545a6d. [PubMed] [CrossRef] [Google Scholar] 36. Siri-Tarino PW, Sun Q, Hu FB, Krauss RM. Насыщенные жиры, углеводы и сердечно-сосудистые заболевания. Являюсь. J. Clin. Nutr. 2010. 91: 502–509. DOI: 10.3945 / ajcn.2008.26285. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 37.Эрикссон-Хоглинг Д. и др. Морфология жировой ткани позволяет прогнозировать улучшение чувствительности к инсулину после умеренной или выраженной потери веса. Int. J. Obes. (Лонд.). 2015; 39: 893–898. DOI: 10.1038 / ijo.2015.18. [PubMed] [CrossRef] [Google Scholar] 38. Тао С., Сифуэнтес А., Голландия, ВЛ. Регулирование гомеостаза глюкозы и липидов адипонектином: влияние на гепатоциты, В-клетки поджелудочной железы и адипоциты. Best Pract. Res. Clin. Эндокринол. Метаб. 2014; 28: 43–58. DOI: 10.1016 / j.beem.2013.11.003. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 39.Сингх П. и др. Дифференциальные эффекты лептина на экспрессию адипонектина. С увеличением веса против ожирения. Int. J. Obes. (Лонд.). 2016; 40: 226–274. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Лю К. и др. Нарушение аутофагии макрофагов увеличивает иммунный ответ у мышей с ожирением, способствуя провоспалительной поляризации макрофагов. Аутофагия. 2015; 11: 271–284. DOI: 10.1080 / 15548627.2015.1009787. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Delgado TC и др. Источники накопления триглицеридов в печени здоровых крыс во время кормления с высоким содержанием жиров.N.M.R. Биомед. 2009. 22: 310–317. [PubMed] [Google Scholar] 42. Brunengraber DZ, et al. Влияние диеты на моделирование триглицеридов жировой ткани во время роста. Являюсь. J. Physiol. Эндокринол. Метаб. 2003. 285: 917–925. DOI: 10.1152 / ajpendo.00128.2003. [PubMed] [CrossRef] [Google Scholar] 43. Амарал С. и др. Изменения метилирования ДНК, вызванные диетой с высоким содержанием жиров и добавлением рыбьего жира в скелетных мышцах мышей. J. Nutrigenet. Нутригеномика. 2015; 7: 314–326. DOI: 10,1159 / 000381777. [PubMed] [CrossRef] [Google Scholar] 44.де Са RD, et al. Рыбий жир предотвращает изменения метаболизма и секреции адипокина в подкожных и висцеральных адипоцитах мышей, вызванные диетой с высоким содержанием жиров. J. Physiol. 2016; 594: 6301–6317. DOI: 10.1113 / JP272541. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Лима, Э. и др. . Добавка масла макадамии уменьшает воспаление и гипертрофию адипоцитов у мышей с ожирением. Медиаторы воспаления . 870634, DOI: 10.1155 / 2014/870634 (2014). [Бесплатная статья PMC] [PubMed] 46. Маси, Л. и др. . Добавки подсолнечного масла обладают провоспалительным действием и не отменяют инсулинорезистентность при ожирении, вызванном диетой с высоким содержанием жиров у мышей C57BL / 6. Дж . Биомед . Биотехнология . 945131, DOI: 10.1155 / 2012/945131 (2012). [Бесплатная статья PMC] [PubMed] 47. Aiken C, Tarry-Adkins J, Penfold N, Dearden L, Ozanne S. Снижение резерва яичников, нарушение регуляции митохондриального биогенеза и повышенное перекисное окисление липидов у потомства самок мышей, подвергшихся ожирению материнской диеты.FASEB J. 2015; 30: 1548–1556. DOI: 10.1096 / fj.15-280800. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 48. Варник Г. Р., Нгуен Т., Бергелин Р. О., Альберс Дж. Дж. Количественное определение липопротеинов: электрофоретический метод по сравнению с клиническим методом исследования липидов. Clin. Chem. 1982; 28: 2116–2120. [PubMed] [Google Scholar] 49. Риц Е.Б., Гильбо Г.Г. Флуорометрическая оценка триглицеридов в сыворотке крови модификацией метода Буколо и Дэвида. Clin. Chem. 1977; 23: 286–268. [PubMed] [Google Scholar] 51.Фридевальд В. Т., Леви Р. И., Фредриксон Д. С.. Оценка концентрации холестерина липопротеидов низкой плотности в плазме без использования препаративной ультрацентрифуги. Clin. Chem. 1972; 18: 499–502. [PubMed] [Google Scholar] 52. Родбелл М. Метаболизм изолированных жировых клеток. I. Влияние гормонов на метаболизм глюкозы и липолиз. J. Biol. Chem. 1964; 239: 375–380. [PubMed] [Google Scholar] 53. Bolsoni-Lopes A, et al. Пальмитолеиновая кислота (n-7) увеличивает липолиз белых адипоцитов и содержание липазы PPAR-зависимым образом.Являюсь. J. Physiol. Эндокринол. Метаб. 2013; 305: 1093–10102. DOI: 10.1152 / ajpendo.00082.2013. [PubMed] [CrossRef] [Google Scholar] 54. Брэдфорд М. Быстрый и чувствительный метод количественного определения количества белка в микрограммах, использующий принцип связывания белок-краситель. Анальный. Biochem. 1976; 72: 248–254. DOI: 10.1016 / 0003-2697 (76) -3. [PubMed] [CrossRef] [Google Scholar] 55. Сен Н.П., Дональдсон Б. Улучшенный колориметрический метод определения нитратов и нитратов в пищевых продуктах. J. Assoc. Выключенный. Анальный. Chem.1978; 61: 1389–1394. [PubMed] [Google Scholar] 57. Шмитген Т.Д., Ливак К.Дж. Анализ данных ПЦР в реальном времени методом сравнительной КТ. Nat. Protoc. 2008; 3: 1101–1108. DOI: 10.1038 / nprot.2008.73. [PubMed] [CrossRef] [Google Scholar] 58. Джеймс Дж и др. Сириус красный гистофотомонетрия и спектрофотометрия срезов в оценке содержания коллагена в ткани печени и его применении в растущей печени крыс. Liver Int. 1990; 10: 1–5. DOI: 10.1111 / j.1600-0676.1990.tb00428.x. [PubMed] [CrossRef] [Google Scholar] 59.Вершуерен Х. Интерференционная отражательная микроскопия в клеточной биологии: методология и приложения. J Cell Sci. 1985; 75: 279–301. [PubMed] [Google Scholar]

Врач обнаружил, что сгущенное молоко содержит больше сахара, чем настоящее молоко!

14 декабря практикующий врач по имени доктор Сити Джуария или более известный как доктор Джуэ опубликовал статью, в которой обнаружил, что подслащенное молоко очень часто используется в повседневном рационе многих людей. Согласно выводам статьи, опубликованной доктором.Цзюэ, сгущенное молоко с сахаром на самом деле имеет более высокий процент сахара, чем коровье молоко, что противоречит распространенному мнению, поскольку подавляющее большинство людей думали, что это, по сути, коровье молоко с небольшим добавлением сахара.

Сгущенное молоко с сахаром — это продукт, который обрабатывают путем добавления в молоко больших количеств сахара. Это необходимо, потому что сахар будет действовать как консервант и гарантирует, что молоко будет храниться в течение многих лет. В дополнение к этому, высокое содержание сахара также вызывает гибель микроорганизмов, которые могут быть обнаружены в молоке, и таким образом служит для поддержания стерильности продукта.

Большинство продаваемых на рынке сгущенных молочных продуктов на самом деле содержат пальмовое масло, которое используется в качестве заменителя коровьего молока, и поэтому большинство сгущенных молочных продуктов с сахаром вообще не содержат молока

Также сообщается, что фактическое содержание сахара в сгущенном молоке с сахаром составляет в среднем 45%, в то время как содержание свежего молока составляет только около 10% или менее

Совершенно очевидно, что мы, потребители, были обмануты рекламой, в которой утверждается, что подслащенные молочные продукты содержат мало жира, различные витамины, такие как витамин D, витамин A и витамин B, а также больше кальция! Это просто ложные утверждения, чтобы заставить потребителей покупать продукт.

Представьте себе количество сахара, потребляемого населением, которое ежедневно употребляет подслащенное молоко. Мы не только используем сгущенное молоко в качестве подсластителя напитков, мы также используем его для изготовления печенья, тортов, различных кондитерских изделий и т. Д.

На самом деле, есть также родители, которые добавляют сгущенное молоко в напитки своим детям вместо сухого молока

Лучше использовать сгущенное молоко вместо сгущенного молока. Сгущенное молоко и сгущенное молоко — аналогичные молочные консервы, из которых была удалена вода.Единственная разница в том, что один подслащенный, а другой нет. Вы получаете такой же молочный вкус от сгущенного молока, а также можете добавлять сахар по своему вкусу и контролировать общее количество сахара в своем рационе.

Всемирная организация здравоохранения недавно рекомендовала резко снизить количество добавленного сахара в ежедневном рационе людей с 10 до 5 процентов. Причина этого в том, что слишком много сахара в рационе человека может нанести серьезный вред его здоровью. Употребление слишком большого количества сахара может действительно испортить вашу кожу, как предполагает исследование, опубликованное в журнале Академии питания и диетологии .Существует взаимосвязь между диетой с высоким содержанием сахара и проблемой прыщей как у взрослых, так и у подростков. Множественные исследования также предполагают связь между потреблением сахара и риском депрессии, поскольку высокое потребление сахара может вызвать воспаление во всем теле, и это связано с более высокими шансами у человека заболеть депрессией.

Так что сделайте себе одолжение и сократите потребление сахара сегодня!

Источник: Д-р Цзюэ / Facebook

.

LEAVE A RESPONSE

Ваш адрес email не будет опубликован.