Трикотажная одежда для дома и отдыха для мужчин и женщин, в интернет магазине Ирис — домашний трикотаж!

Домашний трикотаж от производителя в Иваново, в интернет-магазине «Ирис — домашний трикотаж» Трикотаж дешево, купить ночные сорочки, купить туники, купить трикотаж

Разное

Молекулярная диета: Наноткань для сердца и молекулярная диета: новейшие разработки Сеченовского университета

Содержание

Наноткань для сердца и молекулярная диета: новейшие разработки Сеченовского университета

Сердечная наноткань, напечатанная на 3D-принтере, лазерные швы без рубцов и лечение хронических заболеваний с помощью молекулярной диеты: такие фантастические технологии в области медицины разработали ученые Университета имени Сеченова. Когда эти методы войдут в лечебную практику?

То, что печатает этот лазерный 3D-принтер, ученые Сеченовского университета называют тканеинженерной конструкцией. На самом деле это — надежда для миллионов сердечников, перенесших инфаркт. В технопарке биомедицины разработали устройство, которое печатает многослойную композицию из наночастиц углерода и белков. На нее подсаживают стволовые клетки. Получается ткань, способная проводить нервные импульсы.

«Необходимо сделать конструкцию большего размера и зафиксировать к здоровой части сердца. Когда будет сокращаться здоровая мышца сердца, она будет влечь за собой эту конструкцию, которая, в свою очередь, будет помогать сокращаться отмершей ткани сердца», — объясняет заведующий лабораторией Института бионических технологий и инжиниринга научно-технологического парка биомедицины Сеченовского университета Александр Герасименко.

Ученые Института бионических технологий придумали метод «сварки» живых тканей. На место разреза после операции наносят специальный состав и облучают лазером. Ткани на месте раны буквально склеиваются. Идет уже второй этап исследований — на животных.

Результаты эксперимента — здесь, в виварии Сеченовского университета. Этих крыс лечили с помощью новой лазерной установки, и они практически восстановились после операции.

Маленькому пациенту лаборатории под наркозом сделали четыре надреза скальпелем. Один зашили обычным способом.

«Видно, что один из швов, образованный классическим методом, есть, а лазерные швы не видны», — говорит Александр Герасименко.

Такой шов — водонепроницаемый и не инфицируется. Рубцов не остается. Уже в ближайшее время пациентам клиник Первого меда будут предлагать такой вариант лечения.

«Мы используем это в челюстно-лицевой хирургии для сварки тех или иных разрезов. Дальше это можно будет применить уже и для хрящей и так далее», — говорит директор Института бионических технологий и инжиниринга научно-технологического парка биомедицины Сеченовского университета Дмитрий Телышев.

Новые методы молекулярной диетологии применяют в Клинике управления здоровьем. Рекомендации индивидуальны и даются на основе десятков анализов: проверка на нарушение углеводного обмена и витаминную недостаточность, генетическое исследование.

«Более 100 генов можно смотреть, более 100 точек, чтобы с разных сторон оценить риски, в отношении липидного обмена, в отношении риска сахарного диабета», — говорит врач-диетолог Клиники управления здоровьем Института персонализированной медицины Сеченовского университета Наталья Пугачева.

Ребенок с дефицитом цинка будет много болеть. Расстройства обмена веществ провоцируют аутизм. Молекулярные диетологи уже сегодня могут предсказывать, какие болезни проявятся через 10 лет, если с помощью диеты не влиять на особенности организма. Например, нарушение метаболизма фолиевой кислоты увеличивает риск хронического воспаления, атеросклероза и даже некоторых видов рака как следствия хронического воспаления.

Часто горожане даже не подозревают, сколько тяжелых металлов попадает в их организм при дыхании. Но узнать это просто — по анализу волос на микроэлементы.

«Генетические заболевания типа болезни Вильсона-Коновалова, при которой накапливается избыточная медь в мозге и печени. Раньше считалось, что это заболевание встречается очень редко. Когда мы углубились — да, не в яркой, а в более скрытой форме таких больных очень много. У человека болит печень, болит мозг, рано начинается деменция, слабоумие возникает», — рассказывает заведующий лабораторией молекулярной диетологии Института персонализированной медицины Сеченовского университета Анатолий Скальный.

Обследование нужно проходить раз в пять лет, говорят ученые. Так с помощью одной диеты можно остановить развитие хронических болезней.

В России появятся молекулярные диетологи | Статьи

Еще одну медицинскую специальность — молекулярный диетолог — ввел в образовательный курс Первый МГМУ имени И.М. Сеченова. В настоящий момент она включена в «Атлас новых профессий», а с 1 сентября по этому направлению уже начнется обучение. В компетенцию молекулярного диетолога входит разработка индивидуальных схем питания. Они основаны на анализе генетических факторов и характеристик физиологических процессов конкретного человека, а также влияния на них молекулярного состава пищи. 

Новая специальность предполагает, как знания в области генетики и диетологии, так и понимание процессов производства пищевых продуктов. Параллельно в университете открылось новое подразделение: клиника управления здоровьем на базе Института персонализированной медицины. В этом учреждении врачи новой специальности смогут практиковаться.

Молекулярный диетолог обязан знать, почему геномы всех людей, не исключая и однояйцевых близнецов, различны, рассказала «Известиям» заместитель директора по персонализированным медицинским технологиям Института персонализированной медицины Наталья Жученко. По ее словам, такой специалист должен понимать, что лежит в основе такого разнообразия и неповторимости каждого из нас и почему неповторимость генетической конституции во многом определяет здоровье.

— Пища — это уникальный фактор среды, который необходим каждому человеку. Генетики утверждают, еда — максимально короткий путь к нашим генам. В свою очередь, химические компоненты пищи являются самыми древними модуляторами генной экспрессии (активности генов), и одна из задач молекулярного диетолога заключается в понимании ключевых процессов влияния питания на активность наших генов, — сообщила Наталья Жученко.

Молекулярный диетолог будет оценивать сразу много факторов при разработке индивидуальных схем питания: результаты генетического анализа, особенности физиологических процессов человека, молекулярный состав пищи и др. Врачи уверены, что индивидуально полезная и разнообразная пища способна предотвратить развитие многих заболеваний.

Как пояснил «Известиям» директор Института персонализированной медицины Филипп Копылов, цепочки биохимических процессов сильно отличаются у разных людей. Какие-то процессы в силу генетической предрасположенности идут быстрее, а какие-то медленнее.

— Когда разговор идет про один ген, мы знаем, что он мало вырабатывает белка, который участвует в нужной реакции. Всё очевидно, понятно, все болезни на слуху. Если же стоит задача одновременно оценить 3 тыс. генов, она становится космически сложной. Тем не менее, медицина уже способна решать такие задачи, она становится всё больше математикой, — подчеркнул Филипп Копылов.

Молекулярная диетология кардинально отличается от всех существующих сегодня методик подбора диет, в том числе по крови, рассказала «Известиям» врач-диетолог клиники управления здоровьем Института персонализированной медицины Сеченовского университета Наталья Пугачева.

— Это по сути нутригеномика — наука о влиянии питания человека на экспрессию генов, а не молекулярная кухня, — отметила Наталья Пугачева.

Врач-генетик Мария Балашова рассказала «Известиям», что новая специальность будет очень востребована. По ее словам, есть такие генетические заболевания, повлиять на течение которых, а порой и на выживаемость человека может только диета.

— Например, фенилкетонурия. Это болезнь, при которой в случае несоблюдения низкобелковой диеты развивается поражение центральной нервной системы, в первую очередь приводящее к нарушениям умственного развития. Также это могут быть возраст-ассоциированные заболевания, в том числе остеопороз (нарушение минеральной плотности костной ткани), при котором развиваются переломы. От питания зависит статус системного воспаления. Они часто являются базой для многих заболеваний, в том числе онкологических. Для некоторых видов рака диета, особенно основанная на знании генетики, — мощный профилактический и лечебный фактор. Так, например, доказана взаимосвязь частого употребления в пищу красного мяса и развитие колоректального рака. Для тех, у кого есть предрасположенность к данному заболеванию, красное мясо стоит исключить. 

Как пояснили врачи, современные исследования показывают, что индивидуально составленное правильное питание может значительно продлить активную жизнь человека.

Первый МГМУ имени Сеченова входит в вузы программы повышения конкурентоспособности российского высшего образования «5-100».

ЧИТАЙТЕ ТАКЖЕ

 

Диета и долголетие: молекулярная взаимосвязь

Феномен увеличения продолжительности жизни при условии соблюдения диеты изучают уже 70 лет. Сходные между собой результаты получены для различных видов: от дрожжей до рыб и млекопитающих, включая приматов. Но вплоть до недавнего времени о генетических механизмах, лежащих в основе долголетия, были известно очень немного. Ситуация изменилась, когда около двух лет назад Эндрю Диллин (Andrew Dillin) с коллегами из Института биологических исследований Салка (США) показали, что у червей Caenorhabditis elegans в этих процессах принимает участие транскрипционный фактор PHA-4 (у человека есть три аналогичных гена, принадлежащих к семейству FOXA). Согласно полученным данным, принцип увеличения срока жизни организма при пониженном потреблении калорий основан на взаимодействии генетических факторов и факторов окружающей среды: снижение количества питательных веществ включает генетические процессы, которые обуславливают продолжительность жизни.

Новое исследование, также выполненное в лаборатории Диллина (Andrea C. Carrano et al., A conserved ubiquitination pathway determines longevity in response to diet restriction), показало роль других элементов данного метаболического пути в регуляции продолжительности жизни.

Известно, что нокаут гена WWP-1, участвующего в процессе деградации белков, у C.elegans приводит к повышенной чувствительности животных к внешним стрессорным воздействиям. Эти данные позволили Диллину с коллегами предположить, что данный ген и его белковый продукт играют роль в регуляции продолжительности жизни. Они показали, что черви, мутантные по белку WWP-1, при соблюдении низкокалорийной диеты живут дольше, чем черви с нормально функционирующим белком, содержавшиеся на таком же корме. Предварительные исследования указывают на то, что данный эффект достигается при участии еще одного фермента – UBC-18, работающего в тандеме с WWP-1. Было также показано, что C.elegans с повышенным уровнем экспрессии WWP-1 живут на 25% дольше, чем обычные черви, даже без соблюдения диеты.

Поскольку описываемый метаболический путь консервативен, можно надеяться, что данные, полученные на C.elegans, будут актуальны и для человека. Авторы исследования надеются обнаружить соединения, которые были бы способны повлиять на активность ферментов и имитировать соблюдение низкокалорийной диеты, способствуя продлению жизни без изменения режима питания.

В настоящее время в лаборатории Диллина ведутся работы по поиску рецепторов WWP-1 и UBC-18, которые должны быть основными регуляторами всего процесса. Также ведется поиск малых молекул, которые способны влиять на активность обоих ферментов.

Портал «Вечная молодость» http://vechnayamolodost.ru по материалам The Scientist: Proteins link diet to longevity

30.06.2009

Ученые доказали невозможность создания идеальной диеты

Советы о том, какая диета самая здоровая, постоянно меняются, что затрудняет выбор идеального варианта питания. Исследование австралийских ученых, опубликованное в четверг, внесло большой вклад в понимание того, почему оптимальная диета сводится к особенностям человека, а не к идеальному сочетанию ингредиентов.

Ученые из Австралийского национального центра Phenome (ANPC) при Университете Мердока вместе с партнерами из Имперского колледжа Лондона подтвердили, что у людей могут быть совершенно разные метаболические реакции на одни и те же диеты.

В течение четырех дней они кормили участников исследования идентичным рационом, однако при последующем исследовании их мочи они обнаружили, что она разная по химическому составу.

Одно из различий состояло в том, что организм некоторых участников прилагал больше усилий, чтобы переварить пищу, несмотря на то, что ели столько же еды, как другие, сообщило агентство Хinhua.

Четыре различных диеты, использованных в исследовании, варьировались от очень здоровой, содержащей много фруктов, овощей и клетчатки, до близкой к фастфудной.

Измеряя метаболизм участников с помощью технологии молекулярного анализа, обнаружилось, что различные диеты оказывают большее влияние на организм одних участников, тогда как другие совершенно спокойно едят то же самое без особых перемен в состоянии.

«Некоторые люди были более восприимчивы к диете, чем другие, независимо от того, была ли диета здоровой или нет. Метаболические процессы, которые активировались после каждой диеты, были разными у людей, причем эти различия касались уровня глюкозы в крови», – объяснил директор ANPC и проректор Института здоровья будущего Университета Мердока профессор Джереми Николсон.

Согласно Николсону, некоторые из реакций были вызваны работой кишечных бактерий, что согласуется с фактом о различии состава кишечной микрофлоры, поэтому разные продукты используются бактериями по-разному. Они в каждом случае превращают в энергию разные виды пищи.

Команда ученых считает, что понимание того, как бактерии воспринимают диету на индивидуальном уровне, поможет разработать новые диетические стратегии для поддержания здоровья. А они в свою очередь могут помочь справиться с хроническими заболеваниями, такими как болезни сердца и диабет.

Недавно однояйцевые близнецы поделились результатами своих диетологических экспериментов. Они испытали на себе веганскую и мясную диеты в течение 12 недель, чтобы выяснить, как на каждого из них повлияет диета. Один ел мясо и ни в чем себе не отказывал, второй – держался веганского типа питания.

Бедная углеводами диета замедляет процесс старения

Щадящая низкоуглеводная диета продлевает жизнь. Молекулярный механизм этой зависимости открыли шведские биологи из Гетеборга.

То, что уменьшение объема потребляемых калорий замедляет старение и развитие таких возрастных заболеваний, как рак и диабет второго типа, биологам, подтвердившим эту зависимость в многочисленных экспериментах, известно уже давно. Теперь сделан важный шаг в понимании механизма этой зависимости: молекулярные биологи из Университета Гетеборга (Швеция) выяснили,

как от объема потребляемых калорий зависит активность энзима, играющего важную роль в процессе старения клеток.

«Нам удалось показать, что ограничение потребляемых калорий препятствует инактивации определенного энзима из группы пероксиредоксинов. Этот энзим играет очень важную роль в защите генетического материала клетки от повреждений», — комментирует коллективную статью группы, опубликованную в Molecular Cell, один из авторов открытия Микаэл Молин с факультета клеточной и молекулярной биологии.

Связь между калорийностью питания и скоростью старения у высших животных неоднократно подтверждалась в контролируемых опытах. Так, было установлено, что при постепенном снижении объема углеводов и белков в ежедневном рационе питания животных при сохранении того же уровня потребляемых витаминов и минералов обезьяны, сидящие на такой диете, живут на несколько лет дольше, чем в контрольной группе.

Тот же метод продления жизни и с теми же результатами был опробован на рыбах, мышах, мухах, червях и дрожжах.

Сейчас отрицательная корреляция между объемом потребляемых калорий и продолжительностью жизни считается тривиальным фактом, как и то, что низкокалорийные диеты замедляют развитие возрастных заболеваний. Однако каким образом низкокалорийное питание тормозит старение клеток, оставалось до сих пор неясным.

Группа биологов из Гетеборга, исследуя клетки дрожжей, решила первое и, судя по всему, одно из самых важных уравнений, описывающих связь между питанием, процессами метаболизма и старением. Его ключевым элементом оказался фермент пероксиредоксин-1, или Prx1, — антиоксидантный энзим, защищающий клетку от разрушающего действия перекиси водорода, образующейся в клетках на разных стадиях обмена.

О важной роли, которую играют в функционировании организма белки группы пероксиредоксинов, можно судить по количеству этих ферментов в клетках (в эритроцитах, например, пероксиредоксин-2 занимает второе место после гемоглобина), а также эффектах, вызываемых их дефицитом (у мышей с низким уровнем пероксиредоксинов 1 и 2 развивается анемия и рак крови, а время жизни животных, испытывающих дефицит пероксиредоксина-1, укорачивается на 15%).

Раньше было установлено, что

способность белка Prx1 блокировать сильнейший радикал — молекулу переокисленного водорода — напрямую связана c производством другого энзима сульфиредоксина (Srx1), который восстанавливает окисленную форму Prx1.

Суть же нового открытия, описанного в Molecular Cell, состоит в том, что шведской группе удалось проследить молекулярный механизм, регулирующий уровень сульфиредоксина, который, как выяснилось, зависит от количества потребляемой глюкозы.

В итоге удалось объяснить, почему дрожжи, сидящие на диете, живут дольше дрожжей, получающих лучшее питание.

Интересно, что даже при высококалорийной диете старение все равно замедлялось, если высокий уровень сульфиредоксина поддерживался в клетках искусственно.

«Из-за дисфункции Prx1 генетический материал клетки повреждается, что чревато раком. Необходимо выяснить, может ли поддержание процессов восстановления Prx1 снизить возрастные риски новообразований», — резюмирует Микаэл Молин.

Ученые нашли ключ к стройности без диет

https://ria.ru/20200526/1572025235.html

Ученые нашли ключ к стройности без диет

Ученые нашли ключ к стройности без диет — РИА Новости, 26. 05.2020

Ученые нашли ключ к стройности без диет

Группа ученых из института молекулярной биотехнологии при Австрийской академии наук (IMBA) выяснила, что за худобу человека может отвечать отдельный ген, что,… РИА Новости, 26.05.2020

2020-05-26T18:45

2020-05-26T18:45

2020-05-26T19:23

наука

в мире

диета

открытия — риа наука

здоровье — общество

похудение

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/91865/66/918656699_0:223:4272:2626_1920x0_80_0_0_354a0cf3146bfaf4c55a73f1ab826e8d.jpg

МОСКВА, 26 мая — РИА Новости. Группа ученых из института молекулярной биотехнологии при Австрийской академии наук (IMBA) выяснила, что за худобу человека может отвечать отдельный ген, что, по мнению авторов, поможет в изобретении «лекарства стройности». Результаты исследования опубликованы в журнале Cell.»Большинство ученых изучают ожирение и генетику ожирения. Мы просто поменяли тактику и изучили худобу, открыв новую область для исследований», — заявил один из авторов работы Джозеф Пеннингер.Ученые изучили базу данных эстонского центра генетики и выявили группу людей, которые не полнеют независимо от употребляемой пищи. Среди них авторы и начали искать общие генетические маркеры.Как выяснилось, за худобу может отвечать мутация ALK-гена. Подавление его синтеза, согласно исследованию, может привести к ускоренному сжиганию жира.»ALK широко изучался в контексте рака, но вне данного контекста о биологической роли этого гена известно мало», — отметил Майкл Ортхофер, один из руководителей исследования.Испытания на животных и насекомых показали, что отключение ALK в области гипоталамуса, который, как отмечается, является центральной точкой координации метаболизма, приводит к сжиганию жира.Ученые считают, что подробное изучение этого гена способно привести науку к новой эпохе борьбы с ожирением.

https://ria.ru/20200526/1571982225.html

https://rsport. ria.ru/20200512/1571340322.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/91865/66/918656699_238:0:4035:2848_1920x0_80_0_0_e9042ce3f955c58b27c91ec726325764.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected] ru

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

в мире, диета, открытия — риа наука, здоровье — общество, похудение

МОСКВА, 26 мая — РИА Новости. Группа ученых из института молекулярной биотехнологии при Австрийской академии наук (IMBA) выяснила, что за худобу человека может отвечать отдельный ген, что, по мнению авторов, поможет в изобретении «лекарства стройности». Результаты исследования опубликованы в журнале Cell.

«Большинство ученых изучают ожирение и генетику ожирения. Мы просто поменяли тактику и изучили худобу, открыв новую область для исследований», — заявил один из авторов работы Джозеф Пеннингер.

26 мая 2020, 02:11ФутболДиетолог раскрыла опасность быстрого похудения

Ученые изучили базу данных эстонского центра генетики и выявили группу людей, которые не полнеют независимо от употребляемой пищи. Среди них авторы и начали искать общие генетические маркеры.

Как выяснилось, за худобу может отвечать мутация ALK-гена. Подавление его синтеза, согласно исследованию, может привести к ускоренному сжиганию жира.

«ALK широко изучался в контексте рака, но вне данного контекста о биологической роли этого гена известно мало», — отметил Майкл Ортхофер, один из руководителей исследования.

Испытания на животных и насекомых показали, что отключение ALK в области гипоталамуса, который, как отмечается, является центральной точкой координации метаболизма, приводит к сжиганию жира.

Ученые считают, что подробное изучение этого гена способно привести науку к новой эпохе борьбы с ожирением.

12 мая 2020, 18:30ЗОЖПравильное питание для похудения: диетолог раскрыла меню на каждый день

Ученые назвали идеальную диету для долголетия

Диета, богатая фруктами и овощами, способна снизить риск возникновения сердечно-сосудистых заболеваний, рака и других болезней, которые являются основными причинами смерти.

Ведущий автор исследования, доктор медицинских наук Ван Дун вместе со своими коллегами проанализировал научные данные о потреблении разных продуктов. Анализ показал, что ежедневное употребление именно пяти порций фруктов и овощей снижает риск смертельных болезней. При этом отмечается, что если увеличить число порций, то эффективность диеты снизится.

— Идеально съедать пять порций фруктов и овощей в день. С точки зрения профилактики серьезных хронических заболеваний такое количество потребляемых фруктов и овощей может принести наибольшую пользу, и этот объем потребления сравнительно легко соблюдать большинству людей, — отметил Ван Дун.

Исследователи уточяют, что не все фрукты и овощи полезны для долголетия. Например, горох, кукуруза, картофель не снижают риск смертельных заболеваний. А вот шпинат, латук, цитрусовые, ягоды и морковь отлично подойдут для того, чтобы сохранить здоровье, пишут «Известия».

Как сообщали «Кубанские новости», ранее нутрициолог Марк Гилберт рассказал о правилах питания, способных улучшить здоровье и продлить жизнь.

В первую очередь необходимо сократить общее потребление калорий. По словам специалиста, низкокалорийный рацион может замедлить старение и защитить от развития рака, диабета и болезни Альцгеймера.

Ранее ученые обнаружили омолаживающий эффект малины и ее пользу в борьбе с лишним весом.

Известно, что одна чашка красной малины содержит всего 80 калорий, является источником витамина С и содержит девять граммов клетчатки, что больше чем в любой другой ягоде. При этом у нее низкий гликемический индекс и много фитохимических веществ, которые на молекулярном уровне помогают замедлить старение и избежать ожирения.

Диетологи рекомендуют рекомендуют не пропускать завтраки, при этом в меню могут быть далеко не любые продукты.

Специалисты утверждают, что полезным для организма может оказаться далеко не любой завтрак. Чтобы полученной от утреннего приема пищи энергии хватило и для физической, и для мозговой активности, а качество жизни приятно радовало, надо придерживаться определенных правил здорового питания.

базовые представления о переваривании, абсорбции и метаболизме питательных веществ

Молекулярное питание возникло как новая область в науке о питании после достижений молекулярной биологии и требований к объяснению реакции организма на питательные вещества на молекулярном уровне. К ним относятся экспрессия генов, передача сигналов и ковалентные модификации белков (Müller and Kersten, 2003). Джейкоб и Моно (1961) первыми разработали теорию оперона лактозы, которая является первым примером регуляции генов питательным веществом.Шапиро и др. (1969) выделили ДНК чистого лактозного оперона из Escherichia coli , тем самым полностью продемонстрировав модель лактозного оперона Jacob и Monod (1961). Взаимодействие генов с питательными веществами — это парадигма взаимодействия генома и окружающей среды. Каждый процесс питания основан на взаимодействии большого количества белков, кодируемых молекулами мРНК, которые экспрессируются в данной клетке. Изменения уровней мРНК и, в свою очередь, соответствующих уровней белка (хотя две переменные не обязательно изменяются параллельно) являются критическими параметрами в управлении потоком питательного вещества или метаболита через биохимический путь.Таким образом, молекулярное питание помогло решить фундаментальные вопросы здоровья и предоставило изысканные механистические объяснения причин и следствий.

Применение «омиков», таких как геномика, транскриптом, протеом и метаболом, облегчило понимание молекулярного питания (Afman and Müller, 2006). Например, Kitajka et al. (2004) исследовали изменения экспрессии генов мозга в ответ на различные рационы, обогащенные полиненасыщенными жирными кислотами (ПНЖК) у крыс, с использованием микроматрицы высокой плотности.Они обнаружили, что диета, обогащенная ПНЖК, приводит к значительным изменениям в экспрессии нескольких генов в центральной нервной ткани, и эти эффекты, по-видимому, в основном не зависят от их влияния на состав мембран, облегчая понимание положительных эффектов ω-3 ПНЖК. на нервную систему. Son et al. (2013) исследовали механизм, лежащий в основе повышенного использования аминокислоты глютамина для подпитки анаболических процессов в клетках протоковой аденокарциномы поджелудочной железы (PDAC), используя технологию метаболизма.Они установили, что перепрограммирование метаболизма глутамина опосредуется онкогенными KRAS через активацию транскрипции и репрессию ключевых метаболических ферментов в этом пути.

В этом выпуске

Нам посчастливилось нанять ученых, которые активно работают в области молекулярного питания животных, чтобы поделиться своими исследовательскими данными и взглядами. Во-первых, Юань и др. (2015) описывают некоторые стратегии питания, такие как умеренно высокоэнергетические диеты (Ashworth et al., 1999), витамин A (Whaley et al., 2000), а также добавление L-аргинина (Quesnel et al., 2014) в рацион для уменьшения доли поросят с ограничением внутриутробного роста (ЗВУР) у новорожденных поросят. Не Й.Ф. и другие. (2015) обобщают взаимосвязь между желчными кислотами и кишечными микробами в метаболизме и здоровье хозяина. Потенциальные стратегии питания, используемые для регулирования взаимодействия желчных кислот и кишечных микробов для улучшения здоровья животных, заслуживают нашего внимания.

В этом выпуске Xie et al. (2015) и Chen et al.(2015) оба исследуют профили экспрессии генов переносчиков питательных веществ, которые опосредуют абсорбцию питательных веществ в желудочно-кишечном тракте животных, чтобы предоставить некоторую информацию для стратегий питания. Xie et al. (2015) обнаружили, что двенадцатиперстная кишка является преобладающим местом в немезентериальном пищеварительном тракте для производства предшественников молочного белка и имеет наибольший потенциал для абсорбции растворимого неаммиачного азота (SNAN) в форме пептидно-связанных аминокислот (PBAA). ) в немезентериальных тканях желудочно-кишечного тракта дойных коров.Chen et al. (2015) обнаружили, что экспрессия генов b 0, + AT , EAAT3 , PepT1 , LAT4 , NHE2 , NHE3 и y + LAT2 в малых Кишечник имел положительную корреляцию как с массой тела, так и с массой кишечника домашнего голубя. Однако уровни экспрессии мРНК CAT1 , CAT2 , EAAT2 , SNAT1 и SNAT2 в тонком кишечнике имели обратное.

Как пищевые компоненты влияют на рост и здоровье животных — горячие темы исследований в области питания животных. В этом выпуске многие исследователи исследуют влияние пищевых компонентов на профили экспрессии генов у животных, чтобы дать некоторые объяснения изменения роста и метаболизма животных. Wu et al. (2015) сосредоточены на влиянии уровня белка в рационе на экспрессию переносчиков аминокислот у поросят-отъемышей. По сравнению с группой 17% сырого протеина (CP) и группой 20% CP, группа 14% CP показала самое низкое среднесуточное потребление корма (ADFI) и среднесуточный привес (ADG), а также экспрессию ASCT2 , . 4F2hc и ATB 0 мРНК в тонкой кишке, что указывает на то, что диета с 14% ЦП, дополненная кристаллической аминокислотой (АК), может не транспортировать достаточно АК в организм для поддержания показателей роста поросят.Gao et al. (2015) продемонстрировали, что добавление L-лейцина и L-гистидина в среду может активировать синтез молочных белков, таких как α-казеин, β-казеин и κ-казеин, посредством активации рапамицинового пути у млекопитающих (mTOR) у крупного рогатого скота. эпителиальные клетки молочных желез. Nie C.X. и другие. (2015) обнаружили, что добавление ферментированного хлопкового жмыха (FCSM) в рацион может модулировать метаболизм липидов в тканях и метаболический профиль печени у цыплят-бройлеров. Прием FCSM значительно снижал уровни абдоминального жира и триглицеридов печени и подавлял экспрессию мРНК синтазы жирных кислот и ацетил-КоА-карбоксилазы в тканях печени и экспрессию липопротеинлипазы в брюшной жировой ткани.Добавление FCSM в диету также привело к значительным метаболическим изменениям нескольких путей в печени, включая цикл трикарбоновых кислот, синтез жирных кислот и метаболизм глицеролипидов и АК. Dai et al. (2015) исследовали возможность улучшения здоровья кур-несушек за счет уменьшения плотности их содержания и добавления в рацион таурина. Добавление таурина в рацион улучшило яйценоскость, как ранее сообщалось Wang et al. (2010). Учитывая, что здоровье яйцевода тесно связано с яйценоскостью, Dai et al.(2015) предположили, что добавление таурина в рацион связано с увеличением яйценоскости за счет улучшения функции яйцевода. Интересно, что яйцеводы кур-несушек, выращенных в среде с высокой плотностью населения, можно защитить от травм с помощью пищевых добавок с таурином. Ослабление повреждения яйцеводов было связано с меньшим окислительным стрессом, меньшей инфильтрацией воспалительных клеток и более низкими уровнями медиаторов воспаления в яйцеводах кур-несушек. Предыдущие исследования показали, что некрахмальные полисахаридные ферменты (NSPE) могут улучшить показатели роста животных и улучшить усвоение питательных веществ и иммунитет, что указывает на то, что NSPE играют разностороннюю роль в регулировании метаболических путей (Ao et al., 2010; Zduńczyk et al., 2013). Однако мало что известно о том, как NSPE регулируют метаболизм скелетных мышц. Zhang et al. (2015) использовали изобарическую метку для относительной и абсолютной количественной оценки (iTRAQ), чтобы идентифицировать дифференциально экспрессируемые белки в длиннейшей мышце (LM) растущих свиней, получавших пищевые добавки NSPE. Функциональный анализ дифференциально экспрессируемых белков показал повышенное количество белков, связанных с выработкой энергии, синтезом белка и т. Д.Liang et al. (2015) обнаружили, что экстракт сапонина люцерны (ASE) может повышать экспрессию мРНК рецептора липопротеинов низкой плотности ( Ldlr ) и подавлять экспрессию мРНК рецептора X печени α ( LXRα ) и рецептора фарнезоида X ( FXR ) в Buffalo. клетки печени крысы (BRL). Следовательно, ASE может улучшить стеатоз печени путем регулирования генов, участвующих в метаболизме холестерина. Эти результаты показали, что ASE имеет большой потенциал в качестве природного средства для ослабления гиперлипидемии.Lei et al. (2015) попытались выяснить влияние пребиотика Bacillus subtilis B10 на регулирование ожирения, вызванного диетой с высоким содержанием жиров (HFD). Они добавили 0,1% Bacillus subtilis B10 в HFD и продемонстрировали, что Bacillus subtilis B10 может действовать как полезный пробиотик в контексте ожирения и окислительного стресса.

Мы только вступаем в эру постгеномных исследований, и нет никаких сомнений в том, что молекулярная наука о питании будет представлять центральный интерес, поскольку питательные вещества и другие пищевые компоненты являются ключевыми факторами, влияющими на активность генов и белков.Конечная цель применения мощных методов «омики» — расширить наше понимание метаболизма и питания и определить, как это связано со здоровьем и болезнями животных.

Диета и депрессия: изучение биологических механизмов действия

  • 1.

    Маркс В., Мозли Г., Берк М., Джака Ф. Психиатрия питания: современное состояние доказательств. Proc Nutr Soc. 2017; 76: 427–36.

    PubMed Google ученый

  • 2.

    Джека Ф.Н., О’Нил А., Опи Р., Исиопулос С., Коттон С., Мохебби М. и др. Рандомизированное контролируемое исследование улучшения питания взрослых с большой депрессией (исследование «SMILES»). BMC Med. 2017; 15:23.

    PubMed PubMed Central Google ученый

  • 3.

    Лассейл С., Бэтти Г.Д., Багдадли А., Джека Ф., Санчес-Виллегас А., Кивимаки М. и др. Индексы здорового питания и риск депрессивных исходов: систематический обзор и метаанализ обсервационных исследований.Мол Психиатрия. 2019; 24: 965–86.

    PubMed Google ученый

  • 4.

    Ферт Дж., Маркс В., Дэш С., Карни Р., Тисдейл С. Б., Солми М., Стаббс Б., Шуч Ф. Б., Карвалью А. Ф., Джека Ф., Саррис Дж. Влияние улучшения питания на симптомы депрессии и тревоги : метаанализ рандомизированных контролируемых исследований. Психосоматическая медицина. 2019; 81: 265.

    PubMed PubMed Central Google ученый

  • 5.

    Jacka FN, Pasco JA, Mykletun A, Williams LJ, Hodge AM, O’Reilly SL и др. Связь западных и традиционных диет с депрессией и тревогой у женщин. Am J Psychiatry. 2010; 167: 305–11.

    PubMed Google ученый

  • 6.

    Jacka FN, Pasco JA, Mykletun A, Williams LJ, Nicholson GC, Kotowicz MA, et al. Качество диеты при биполярном расстройстве в выборке женщин. J влияет на Disord. 2011; 129: 332–7.

    PubMed Google ученый

  • 7.

    Халид С., Уильямс С.М., Рейнольдс С.А. Есть ли связь между диетой и депрессией у детей и подростков? Систематический обзор. Br J Nutr. 2016; 116: 2097–108.

    CAS PubMed Google ученый

  • 8.

    Borge TC, Aase H, Brantsæter AL, Biele G. Важность качества питания матери во время беременности для когнитивных и поведенческих исходов у детей: систематический обзор и метаанализ. BMJ Open. 2017; 7: e016777.

    PubMed PubMed Central Google ученый

  • 9.

    Parletta N, Zarnowiecki D, Cho J, Wilson A, Bogomolova S, Villani A, Itsiopoulos C, Niyonsenga T, Blunden S, Meyer B, Segal L. Диета в средиземноморском стиле с добавлением рыбьего жира улучшает качество диеты и психическое здоровье у людей с депрессией: рандомизированное контролируемое исследование (HELFIMED). Пищевая нейробиология. 2019; 22: 474–87.

    CAS PubMed Google ученый

  • 10.

    Фрэнсис Х.М., Стивенсон Р. Дж., Чемберс Дж. Р., Гупта Д., Ньюи Б., Лим СК. Кратковременное диетическое вмешательство может уменьшить симптомы депрессии у молодых людей — рандомизированное контролируемое исследование. ПлоС один. 2019; 14: e0222768.

    CAS PubMed PubMed Central Google ученый

  • 11.

    Ма Дж., Росас Л.Г., Ур. Н., Сяо Л., Сноуден М.Б., Вендитти Е.М. и др. Влияние комплексного поведенческого лечения по снижению веса и терапии для решения проблем на индекс массы тела и депрессивные симптомы у пациентов с ожирением и депрессией: рандомизированное клиническое исследование RAINBOW.Джама. 2019; 321: 869–79.

    PubMed PubMed Central Google ученый

  • 12.

    Бот М., Брауэр И.А., Рока М., Колс Э., Пеннинкс Б., Уоткинс Э. и др. Влияние полинутриентных добавок и терапии поведенческой активации, связанной с пищевыми продуктами, на профилактику большого депрессивного расстройства у взрослых с избыточным весом или ожирением с субсиндромальными депрессивными симптомами: рандомизированное клиническое исследование MooDFOOD. Джама. 2019; 321: 858–68.

    CAS PubMed PubMed Central Google ученый

  • 13.

    Санчес-Вильегас А., Мартинес-Гонсалес М., Эструч Р., Салас-Сальвадо Дж., Корелла Д., Ковас М. и др. Средиземноморский режим питания и депрессия: рандомизированное исследование PREDIMED. BMC Med. 2013; 11: 208.

    PubMed PubMed Central Google ученый

  • 14.

    Берк М., Уильямс Л.Дж., Джека Ф.Н., О’Нил А., Паско Дж. А., Мойлан С. и др. Итак, депрессия — это воспалительное заболевание, но откуда взялось воспаление? BMC Med. 2013; 11: 200.

    PubMed PubMed Central Google ученый

  • 15.

    Cryan JF, O’Riordan KJ, Cowan CS, Sandhu KV, Bastiaanssen TF, Boehme M, et al. Ось микробиота-кишечник-мозг. Physiol Rev.2019; 99: 1877–2013.

    CAS PubMed Google ученый

  • 16.

    Маес М., Галецки П., Чанг Ю.С., Берк М. Обзор путей окислительного и нитрозативного стресса (O&NS) при большой депрессии и их возможного вклада в (нейро) дегенеративные процессы при этом заболевании.Prog Neuropsychopharmacol Biol Psychiatry. 2011; 35: 676–92.

    CAS PubMed Google ученый

  • 17.

    Pariante CM, Lightman SL. Ось HPA в большой депрессии: классические теории и новые разработки. Trends Neurosci. 2008; 31: 464–8.

    CAS PubMed Google ученый

  • 18.

    Карвалью А.Ф., Солми М., Санчес М., Мачадо М.О., Стаббс Б., Айнакина О. и др.Основанный на фактах зонтичный обзор 162 периферических биомаркеров основных психических расстройств. Перевод Психиатрия. 2020; 10: 1–13.

    Google ученый

  • 19.

    Bauer ME, Teixeira AL. Воспаление при психических расстройствах: что первично? Ann N Y Acad Sci. 2019; 1437: 57–67.

    CAS PubMed Google ученый

  • 20.

    Осимо Э. Ф., Кардинал Р. Н., Джонс П. Б., Хандакер Г. М.. Распространенность и корреляты системного воспаления низкой степени у взрослых психиатрических стационаров: исследование на основе электронных медицинских карт.Психонейроэндокринология. 2018; 91: 226–34.

    PubMed PubMed Central Google ученый

  • 21.

    Миллер А.Х., Raison CL. Роль воспаления в депрессии: от эволюционного императива к современной цели лечения. Nat Rev Immunol. 2016; 16: 22–34.

    CAS PubMed PubMed Central Google ученый

  • 22.

    Капурон Л., Миллер А.Х. Цитокины и психопатология: уроки интерферона-альфа.Биол Психиатрия. 2004; 56: 819–24.

    CAS PubMed Google ученый

  • 23.

    Поллак Ю., Йирмия Р. Цитокин-индуцированные изменения настроения и поведения: последствия для «депрессии из-за общего состояния здоровья», иммунотерапии и антидепрессивного лечения. Int J Neuropsychopharmacol. 2002; 5: 389–99.

    CAS PubMed Google ученый

  • 24.

    Хепгул Н., Парианте С.М., Баральди С., Борсини А., Буфалино С., Рассел А. и др.Депрессия и тревога у пациентов, получающих интерферон-альфа: роль восприятия болезни. J Health Psychol. 2018; 23: 1405–14.

    PubMed Google ученый

  • 25.

    Келер ‐ Форсберг О., Лидхольм С.Н., Хьортой К., Нордентофт М., Морс О., Бенрос М.Э. Эффективность противовоспалительного лечения большого депрессивного расстройства или депрессивных симптомов: метаанализ клинических испытаний. Acta Psychiatr Scand. 2019; 139: 404–19.

    PubMed Google ученый

  • 26.

    Касторини С.М., Милионис Х.Дж., Эспозито К., Джульяно Д., Гудевенос Я.А., Панайотакос ДБ. Влияние средиземноморской диеты на метаболический синдром и его компоненты: метаанализ 50 исследований с участием 534 906 человек. J Am Coll Cardiol. 2011; 57: 1299–313.

    CAS PubMed Google ученый

  • 27.

    Эспозито К., Марфелла Р., Чиотола М., Ди Пало С., Джульяно Ф., Джульяно Дж. И др. Влияние средиземноморской диеты на дисфункцию эндотелия и маркеры сосудистого воспаления при метаболическом синдроме: рандомизированное исследование.Джама. 2004. 292: 1440–6.

    CAS PubMed Google ученый

  • 28.

    Джульяно Д., Чериелло А., Эспозито К. Влияние диеты на воспаление: акцент на метаболический синдром. J Am Coll Cardiol. 2006. 48: 677–85.

    CAS PubMed Google ученый

  • 29.

    Ферт Дж., Стаббс Б., Тисдейл С.Б., Уорд П.Б., Веронезе Н., Шиваппа Н. и др. Диета как горячая тема в психиатрии: популяционное исследование потребления пищевых продуктов и воспалительного потенциала при тяжелых психических заболеваниях.Мировая психиатрия. 2018; 17: 365–7.

    PubMed PubMed Central Google ученый

  • 30.

    Яхфуфи Н., Алсади Н., Джамби М., Матар С. Иммуномодулирующая и противовоспалительная роль полифенолов. Питательные вещества. 2018; 10: 11.

    Google ученый

  • 31.

    Ляо Й, Се Б., Чжан Х, Хе Кью, Го Л., Субраманиапиллай М. и др. Эффективность омега-3 ПНЖК при депрессии: метаанализ.Перевод Психиатрия. 2019; 9: 190.

    PubMed PubMed Central Google ученый

  • 32.

    Су КП, Лай Х.С., Ян Х.Т., Су ВП, Пэн С.Й., Чанг Дж. П. и др. Омега-3 жирные кислоты в профилактике депрессии, вызванной интерфероном-альфа: результаты рандомизированного контролируемого исследования. Биол психиатрия. 2014; 76: 559–66.

    CAS PubMed Google ученый

  • 33.

    Rapaport MH, Nierenberg AA, Schettler PJ, Kinkead B, Cardoos A, Walker R, et al.Воспаление как прогностический биомаркер реакции на омега-3 жирные кислоты при большом депрессивном расстройстве: исследование, подтверждающее концепцию. Мол Психиатрия. 2016; 21: 71–9.

    CAS PubMed Google ученый

  • 34.

    Borsini A, Alboni S, Horowitz MA, Tojo LM, Cannazza G, Su KP, et al. Спасение индуцированного IL-1beta снижения нейрогенеза человека с помощью омега-3 жирных кислот и антидепрессантов. Иммунное поведение мозга. 2017; 65: 230–8.

    CAS PubMed PubMed Central Google ученый

  • 35.

    Мойлан С., Берк М., Дин О.М., Самуни И., Уильямс Л.Дж., О’Нил А. и др. Окислительный и нитрозативный стресс при депрессии: зачем столько стресса? Neurosci Biobehav Rev.2014; 45: 46–62.

    CAS PubMed Google ученый

  • 36.

    Лю Т., Чжун С., Ляо Х, Чен Дж, Хе Т, Лай С. и др. Метаанализ маркеров окислительного стресса при депрессии. PLOS ONE. 2015; 10: e0138904.

    PubMed PubMed Central Google ученый

  • 37.

    Che Y, Wang J-F, Shao L, Young LT. Окислительное повреждение РНК, но не ДНК в гиппокампе пациентов с серьезным психическим заболеванием. J Psychiatry Neurosci. 2010; 35: 296.

    PubMed PubMed Central Google ученый

  • 38.

    Gao S-F, Qi X-R, Zhao J, Balesar R, Bao A-M, Swaab D.F. Снижение экспрессии NOS1 в передней поясной коре при депрессии. Cereb Cortex. 2013; 23: 2956–64.

    PubMed Google ученый

  • 39.

    Моррисон С.Д., Пистелл П.Дж., Инграм Д.К., Джонсон В.Д., Лю Й., Фернандес-Ким С.О. и др. Диета с высоким содержанием жиров увеличивает оксидативный стресс в гиппокампе и когнитивные нарушения у старых мышей: последствия для снижения передачи сигналов Nrf2. J Neurochem. 2010; 114: 1581–9.

    CAS PubMed PubMed Central Google ученый

  • 40.

    Studzinski CM, Li F, Брюс-Келлер AJ, Фернандес-Ким SO, Zhang L, Weidner AM, et al. Влияние краткосрочной западной диеты на церебральный оксидативный стресс и факторы, связанные с диабетом, у мышей с нокаутом APP × PS1.J Neurochem. 2009. 108: 860–6.

    CAS PubMed Google ученый

  • 41.

    Cocate PG, Натали А.Дж., де Оливейра А., Лонго Г.З., Рита де Касия Г.А., Мария и др. Потребление фруктов и овощей и связанных с ними питательных веществ связано с маркерами окислительного стресса у мужчин среднего возраста. Питание. 2014; 30: 660–5.

    CAS PubMed Google ученый

  • 42.

    Дай Дж., Джонс Д.П., Голдберг Дж., Зиглер Т.Р., Бостик Р.М., Уилсон П.В. и др.Связь между соблюдением средиземноморской диеты и окислительным стрессом. Am J Clin Nutr. 2008; 88: 1364–70.

    CAS PubMed PubMed Central Google ученый

  • 43.

    Meyer KA, Sijtsma FP, Nettleton JA, Steffen LM, Van Horn L, Shikany JM, et al. Характер питания связан с F2-изопростанами плазмы в наблюдательном когортном исследовании взрослых. Free Radic Biol Med. 2013; 57: 201–9.

    CAS PubMed Google ученый

  • 44.

    Трабер М.Г., Стивенс Дж. Ф. Витамины C и E: положительные эффекты с механической точки зрения. Free Radic Biol Med. 2011; 51: 1000–13.

    CAS PubMed PubMed Central Google ученый

  • 45.

    Фернандес Б.С., Дин О.М., Додд С., Малхи Г.С., Берк М. N-ацетилцистеин в депрессивных симптомах и функциональных возможностях: систематический обзор и метаанализ. Журнал клинической психиатрии. 2016; 77: 457–66.

    Google ученый

  • 46.

    Чжан Х., Цао Р. Диетические полифенолы, окислительный стресс, антиоксидантные и противовоспалительные эффекты. Curr Opin Food Sci. 2016; 8: 33–42.

    Google ученый

  • 47.

    Cryan JF, O’Riordan KJ, Cowan CSM, Sandhu KV, Bastiaanssen TFS, Boehme M, et al. Ось микробиота-кишечник-мозг. Physiol Rev.2019; 99: 1877–2013.

    CAS PubMed Google ученый

  • 48.

    Хупер Л.В., Литтман Д.Р., Макферсон А.Дж.Взаимодействие между микробиотой и иммунной системой. Наука. 2012; 336: 1268–73.

    CAS PubMed PubMed Central Google ученый

  • 49.

    Огбонная Е.С., Кларк Дж., Шанахан Ф., Динан Т.Г., Крайан Дж. Ф., О’Лири О.Ф. Нейрогенез гиппокампа взрослых регулируется микробиомом. Биол Психиатрия. 2015; 78: e7–9.

    PubMed Google ученый

  • 50.

    Gheorghe CE, Martin JA, Manriquez FV, Dinan TG, Cryan JF, Clarke G.Сосредоточьтесь на главном: метаболизме триптофана и оси микробиом-кишечник-мозг. Curr Opin Pharmacol. 2019; 48: 137–45.

    CAS PubMed Google ученый

  • 51.

    van de Wouw M, Walsh AM, Crispie F, van Leuven L, Lyte JM, Boehme M, et al. Определенное действие кефира из ферментированного напитка на поведение хозяина, иммунитет и микробиомные модули кишечника и мозга у мышей. Микробиом. 2020; 8: 1–20.

    Google ученый

  • 52.

    Shi H, Wang Q, Zheng M, Hao S, Lum JS, Chen X и др. Добавка углеводов, доступных для микробиоты, предотвращает нейровоспаление и снижение когнитивных функций за счет улучшения оси кишечная микробиота-мозг у мышей с ожирением, вызванным диетой. J Нейровоспаление. 2020; 17: 1–21.

    Google ученый

  • 53.

    Динан Т.Г., Стэнтон С., Лонг-Смит С., Кеннеди П., Крайан Дж. Ф., Коуэн С.С.М и др. Кормление меланхолических микробов: рекомендации MyNewGut по диете и настроению.Clin Nutr. 2019; 38: 1995–2001.

    PubMed Google ученый

  • 54.

    Ohland CL, Kish L, Bell H, Thiesen A, Hotte N, Pankiv E, et al. Воздействие Lactobacillus helveticus на поведение мышей зависит от диеты и генотипа и коррелирует с изменениями в микробиоме кишечника. Психонейроэндокринология. 2013; 38: 1738–47.

    CAS PubMed Google ученый

  • 55.

    Pyndt Jorgensen B, Winther G, Kihl P, Nielsen DS, Wegener G, Hansen AK и др. Дефицит магния в пище влияет на микробиоту кишечника и тревожное поведение мышей C57BL / 6N. Acta Neuropsychiatr. 2015; 27: 307–11.

    PubMed Google ученый

  • 56.

    Магнуссон К.Р., Хаук Л., Джеффри Б.М., Элиас В., Хамфри А., Нат Р. и др. Взаимосвязь между изменениями микробиома кишечника, связанными с диетой, и когнитивной гибкостью. Неврология.2015; 300: 128–40.

    CAS PubMed Google ученый

  • 57.

    Reichelt AC, Loughman A, Bernard A, Raipuria M, Abbott KN, Dachtler J, Van TT, Moore RJ. Прерывистая гиперкалорийная диета изменяет микробиоту кишечника, экспрессию генов префронтальной коры и социальное поведение у крыс. Пищевая нейробиология. 2020; 23: 613–27.

    CAS PubMed Google ученый

  • 58.

    Бурокас А., Арболея С., Молони Р.Д., Петерсон В.Л., Мерфи К., Кларк Г. и др. Нацеленность на ось микробиота-кишечник-мозг: пребиотики обладают анксиолитическим и антидепрессантным действием и обращают вспять влияние хронического стресса на мышей. Биол Психиатрия. 2017; 82: 472–87.

    CAS PubMed Google ученый

  • 59.

    Крайан Дж. Ф., О’Риордан К. Дж., Сандху К., Петерсон В., Динан Т. Г.. Микробиом кишечника при неврологических расстройствах. Lancet Neurol. 2020; 19: 179–94.

    CAS PubMed Google ученый

  • 60.

    Валлес-Коломер М., Фалони Дж., Дарзи И., Тигчелаар Э. Ф., Ван Дж., Тито Р. Я. и др. Нейроактивный потенциал микробиоты кишечника человека в качестве жизни и депрессии. Nat Microbiol. 2019; 4: 623–32.

    CAS PubMed Google ученый

  • 61.

    Дэвид Л.А., Морис К.Ф., Кармоди Р.Н., Гутенберг Д.Б., Баттон Дж. Э., Вулф Б. Э. и др.Диета быстро и воспроизводимо изменяет микробиом кишечника человека. Природа. 2014; 505: 559–63.

    CAS PubMed Google ученый

  • 62.

    Wu GD, Chen J, Hoffmann C, Bittinger K, Chen YY, Keilbaugh SA, et al. Связывание долгосрочных диетических моделей с кишечными микробными энтеротипами. Наука. 2011; 334: 105–8.

    CAS PubMed PubMed Central Google ученый

  • 63.

    Брюс-Келлер А.Дж., Салбаум Дж.М., Луо М., Бланшар и др., Тейлор С.М., Валлийский Д.А. и др.Микробиота кишечника с ожирением вызывает нейроповеденческие изменения при отсутствии ожирения. Биол Психиатрия. 2015; 77: 607–15.

  • 64.

    Hiel S, Bindels LB, Pachikian BD, Kalala G, Broers V, Zamariola G, et al. Влияние диеты, основанной на богатых инулином овощах, на здоровье кишечника и пищевое поведение здоровых людей. Am J Clin Nutr. 2019; 109: 1683–95.

    PubMed PubMed Central Google ученый

  • 65.

    Гош Т.С., Рампелли С., Джеффри И.Б., Санторо А., Нето М., Капри М., Джампьери Е., Дженнингс А., Кандела М., Туррони С., Зоетендал Е.Г.Средиземноморская диета изменяет микробиом кишечника у пожилых людей, уменьшая слабость и улучшая состояние здоровья: годичное диетическое вмешательство NU-AGE в пяти европейских странах. Кишечник. 2020; 69: 1218–1228.

    CAS PubMed PubMed Central Google ученый

  • 66.

    Робертсон Р.К., Сейра Ориач С., Мерфи К., Молони Г.М., Крайан Дж.Ф., Динан Т.Г. и др. Полиненасыщенные жирные кислоты омега-3 критически регулируют поведение и развитие кишечной микробиоты в подростковом и взрослом возрасте.Иммунное поведение мозга. 2017; 59: 21–37.

    CAS PubMed Google ученый

  • 67.

    Pasinetti GM, Singh R, Westfall S, Herman F, Faith J, Ho L. Роль кишечной микробиоты в метаболизме полифенолов, характерная для мышей-гнотобиотов. J. Alzheimers Dis. 2018; 63: 409–21.

    CAS PubMed PubMed Central Google ученый

  • 68.

    Оздал Т., Села Д.А., Сяо Дж., Бояджоглу Д., Чен Ф., Капаноглу Э.Взаимодействие между полифенолами и микробиотой кишечника и влияние на биодоступность. Питательные вещества. 2016; 8: 78.

    PubMed PubMed Central Google ученый

  • 69.

    Лонг-Смит К., О’Риордан К.Дж., Кларк Дж., Стэнтон К., Динан Т.Г., Крайан Дж.Ф. Ось микробиота-кишечник-мозг: новые терапевтические возможности. Ежегодный обзор фармакологии и токсикологии. 2020; 60 (январь): 477–502.

    CAS PubMed Google ученый

  • 70.

    Liu RT, Walsh RF, Sheehan AE. Пребиотики и пробиотики при депрессии и тревоге: систематический обзор и метаанализ контролируемых клинических испытаний. Неврология и биоповеденческие обзоры. 2019; 102 (июл): 13–23.

    CAS Google ученый

  • 71.

    Аслам Х, Грин Дж., Джека Ф. Н., Кольер Ф, Берк М., Паско Дж., Доусон С. Л.. Ферментированные продукты, кишечник и психическое здоровье: механистический обзор, влияющий на депрессию и тревогу.Пищевая нейробиология. 2020; 23 (сен): 659–71.

    CAS PubMed Google ученый

  • 72.

    Бамбери А., Сандху К., Крайан Дж. Ф., Динан Т. Г.. В поисках иголки в стоге сена: систематическая идентификация психобиотиков. Br J Pharmacol. 2018; 175: 4430–8.

    CAS PubMed PubMed Central Google ученый

  • 73.

    Suez J, Zmora N, Segal E, Elinav E. Плюсы, минусы и многие неизвестные пробиотики.Nat Med. 2019; 25: 716–29.

    CAS PubMed Google ученый

  • 74.

    Хидезе С., Ногава С., Сайто К., Кунуги Х. Пищевая аллергия связана с депрессией и психологическим расстройством: интернет-исследование с участием 11 876 японцев. J влияет на Disord. 2019; 245: 213–8.

    PubMed Google ученый

  • 75.

    Portsmouth Uo. Литературные поиски и обзоры, связанные с распространенностью пищевой аллергии в Европе.Поддержка EFSA Publ. 2013; 10: 506E.

    Google ученый

  • 76.

    Ярвинен К.М., Константину Г.Н., Пилапил М., Арриета М.С., Ноун С., Сампсон Х.А. и др. Кишечная проницаемость у детей с пищевой аллергией, соблюдающих специальные элиминационные диеты. Pediatr Allergy Immunol. 2013; 24: 589–95.

    PubMed PubMed Central Google ученый

  • 77.

    Маес М., Кубера М., Леунис Дж. Барьер между кишечником и мозгом при большой депрессии: дисфункция слизистой оболочки кишечника с повышенной транслокацией ЛПС из грамотрицательных энтеробактерий (негерметичная кишка) играет роль в воспалительной патофизиологии депрессии.Neuro Endocrinol Lett. 2008; 29: 117–24.

    PubMed Google ученый

  • 78.

    Lerner BA, Green PH, Lebwohl B. Идем против зерна: безглютеновая диета у пациентов без целиакии — стоит того или нет? Dig Dis Sci. 2019; 64: 1740–7.

    PubMed Google ученый

  • 79.

    Haq MRU, Kapila R, Sharma R, Saliganti V, Kapila S. Сравнительная оценка потребления коровьих вариантов β-казеина (A1 / A2) на Th 2-опосредованный воспалительный ответ в кишечнике мыши.Eur J Nutr. 2014; 53: 1039–49.

    Google ученый

  • 80.

    Нотон М., Динан Т.Г., Скотт Л.В. Кортикотропин-рилизинг-гормон и гипоталамо-гипофизарно-надпочечниковая система при психических заболеваниях. Handb Clin Neurol. 2014; 124: 69–91.

    PubMed Google ученый

  • 81.

    Brody S, Preut R, Schommer K, Schürmeyer TH. Рандомизированное контролируемое исследование высоких доз аскорбиновой кислоты для снижения артериального давления, кортизола и субъективных реакций на психологический стресс.Психофармакология. 2002; 159: 319–24.

    CAS PubMed Google ученый

  • 82.

    Барбадоро П., Аннино И., Понцио Е., Романелли Р.М., Д’Эррико М.М., Просперо Е. и др. Добавки рыбьего жира снижают базальный уровень кортизола и воспринимаемый стресс: рандомизированное плацебо-контролируемое исследование с участием лиц, воздерживающихся от алкоголя. Mol Nutr Food Res. 2013; 57: 1110–4.

    CAS PubMed Google ученый

  • 83.

    Delarue J, Matzinger O, Binnert C, Schneiter P, Chiolero R, Tappy L. Рыбий жир предотвращает активацию надпочечников, вызванную умственным стрессом у здоровых мужчин. Диабет Метаб. 2003. 29: 289–95.

    CAS PubMed Google ученый

  • 84.

    Цанг С., Ходжсон Л., Буссу А., Фархат Г., Аль-Дуджайли Э. Влияние темного шоколада, богатого полифенолами, на кортизол в слюне и настроение у взрослых. Антиоксиданты. 2019; 8: 149.

    CAS PubMed Central Google ученый

  • 85.

    Цанг С., Смаил Н.Ф., Альмосави С., Дэвидсон И., Аль-Дуджайли Е.А. Потребление богатого полифенолами чистого сока граната влияет на уровень глюкокортикоидов в моче, артериальное давление и оценку гомеостаза инсулинорезистентности у добровольцев. J Nutr Sci. 2012; 1: e9.

    PubMed PubMed Central Google ученый

  • 86.

    Дхабхар Ф.С. Стресс-индуцированное усиление клеточного иммунитета. Ann N Y Acad Sci. 1998; 840: 359–72.

    CAS PubMed Google ученый

  • 87.

    Аль-Дуджайли Э.А., Эшмор С., Цанг С. Краткое исследование, посвященное влиянию гликемического индекса диеты на потребление энергии и стероидные гормоны слюны. Питательные вещества. 2019; 11: 260.

    CAS PubMed Central Google ученый

  • 88.

    Гаро М.Г., Жюри Дж., Маккуин Дж., Шерман П.М., Пердью М.Х. Обработка крысят пробиотиками нормализует высвобождение кортикостерона и улучшает дисфункцию толстой кишки, вызванную разлучением с матерью. Кишечник.2007; 56: 1522–8.

    CAS PubMed PubMed Central Google ученый

  • 89.

    Messaoudi M, Lalonde R, Violle N, Javelot H, Desor D, Nejdi A, et al. Оценка психотропных свойств пробиотического препарата (Lactobacillus helveticus R0052 и Bifidobacterium longum R0175) на крысах и людях. Br J Nutr. 2011; 105: 755–64.

    CAS PubMed Google ученый

  • 90.

    Рудски Л., Островска Л., Павляк Д., Малус А., Павляк К., Вашкевич Н. и др. Пробиотик lactobacillus plantarum 299v снижает концентрацию кинуренина и улучшает когнитивные функции у пациентов с большой депрессией: двойное слепое рандомизированное плацебо-контролируемое исследование. Психонейроэндокринология. 2019; 100: 213–22.

    CAS PubMed Google ученый

  • 91.

    Fanselow MS, Dong HW. Различны ли функционально дорсальный и вентральный гиппокамп? Нейрон.2010; 65: 7–19.

    CAS PubMed PubMed Central Google ученый

  • 92.

    Anacker C, Hen R. Нейрогенез гиппокампа взрослых и когнитивная гибкость — связь памяти и настроения. Обзоры природы Неврология. 2017; 18 (июн): 335–46.

    CAS PubMed PubMed Central Google ученый

  • 93.

    Toda T, Parylak SL, Linker SB, Gage FH. Роль нейрогенеза гиппокампа взрослых в здоровье и болезнях мозга.Мол Психиатрия. 2019; 24: 67–87.

    CAS PubMed Google ученый

  • 94.

    Кареге Ф, Перре Дж., Бондольфи Дж., Швальд М., Берчи Дж., Обри Дж. М.. Снижение уровней нейротрофических факторов головного мозга в сыворотке крови у пациентов с тяжелой депрессией. Psychiatry Res. 2002; 109: 143–8.

    CAS PubMed Google ученый

  • 95.

    Филус Дж. Ф., Рыбаковски Дж. Нейротрофические факторы и их роль в патогенезе аффективных расстройств.Psychiatr Pol. 2005; 39: 883–97.

    PubMed Google ученый

  • 96.

    Caviedes A, Lafourcade C, Soto C, Wyneken U. Передача сигналов BDNF / NF-kappaB в нейробиологии депрессии. Curr Pharm Des. 2017; 23: 3154–63.

    CAS PubMed Google ученый

  • 97.

    Зайнуддин М.С., Турет С. Питание, нейрогенез гиппокампа взрослых и психическое здоровье. Br Med Bull. 2012; 103: 89–114.

    PubMed Google ученый

  • 98.

    Kanoski SE, Davidson TL. Западная диета и когнитивные нарушения: связь с дисфункцией гиппокампа и ожирением. Physiol Behav. 2011; 103: 59–68.

    CAS PubMed Google ученый

  • 99.

    Savignac HM, Corona G, Mills H, Chen L, Spencer JP, Tzortzis G, et al. Пребиотическое питание повышает уровень нейротрофического фактора центрального мозга, субъединиц рецептора N-метил-D-аспартата и D-серина.Neurochemistry Int. 2013; 63: 756–64.

    CAS Google ученый

  • 100.

    Balanza-Martinez V, Fries GR, Colpo GD, Silveira PP, Portella AK, Tabares-Seisdedos R, et al. Терапевтическое использование омега-3 жирных кислот при биполярном расстройстве. Эксперт Rev Neurother. 2011; 11: 1029–47.

    PubMed Google ученый

  • 101.

    Dias GP, Cavegn N, Nix A, do Nascimento Bevilaqua MC, Stangl D, Zainuddin MS, et al.Роль диетических полифенолов на нейрогенез гиппокампа взрослых: молекулярные механизмы и поведенческие эффекты при депрессии и тревоге. Oxid Med Cell Longev. 2012; 2012: 541971.

    PubMed PubMed Central Google ученый

  • 102.

    Zainuddin MSA, Thuret S. Nutrition, нейрогенез гиппокампа взрослых и психическое здоровье. Br Med Bull. 2012; 103: 89–114.

    PubMed Google ученый

  • 103.

    Jacka FN, Cherbuin N, Anstey KJ, Sachdev P, Butterworth P. Западная диета связана с меньшим размером гиппокампа: продольное исследование. BMC медицина. 2015; 13: 1–8.

    Google ученый

  • 104.

    Акбарали Т., Секстон С., Жолдос Э., Махмуд А., Филиппини Н., Керло С. и др. Связь качества долгосрочной диеты с объемом гиппокампа: продольное когортное исследование. Am J Med. 2018; 131: 1372–81.e4.

    PubMed PubMed Central Google ученый

  • 105.

    Croll PH, Voortman T, Ikram MA, Franco OH, Schoufour JD, Bos D, et al. Лучшее качество диеты связано с большими объемами мозговой ткани: исследование в Роттердаме. Неврология. 2018; 90: e2166–73.

    PubMed Google ученый

  • 106.

    Санчес-Виллегас А., Гальбете С., Мартинес-Гонсалес МА, Мартинес Х.А., Разкин С., Салас-Сальвадо Дж. И др. Влияние средиземноморской диеты на уровни нейротрофического фактора мозга (BDNF) в плазме крови: рандомизированное исследование PREDIMED-NAVARRA.Nutr Neurosci. 2011; 14: 195–201.

    PubMed Google ученый

  • 107.

    Pan W, Banks WA, Fasold MB, Bluth J, Kastin AJ. Транспорт нейротрофического фактора головного мозга через гематоэнцефалический барьер. Нейрофармакология. 1998. 37: 1553–61.

    CAS PubMed Google ученый

  • 108.

    Гейл А.К., Эневольд С., Багге А., Андерсен М.С., Нильсен С.Х., Андерсен Л.Б. Связь между нейротрофическим фактором головного мозга сыворотки и плазмы и влияние времени хранения и стратегии центрифугирования.Научный доклад 2019; 9: 1–9.

    CAS Google ученый

  • 109.

    Маттсон М.П., ​​Дуан В., Го З. Размер и частота приема пищи влияют на пластичность нейронов и уязвимость к болезням: клеточные и молекулярные механизмы. J Neurochem. 2003. 84: 417–31.

    CAS PubMed Google ученый

  • 110.

    Стивенсон Р.Дж., Фрэнсис Х.М., Аттукуайефио Т., Гупта Д., Йоманс М.Р., Оатен М.Дж. и др. Зависящий от гиппокампа контроль аппетита нарушается экспериментальным воздействием диеты западного образца.R Soc Open Sci. 2020; 7: 1

    .

    CAS PubMed PubMed Central Google ученый

  • 111.

    Attuquayefio Т., Стивенсон Р.Дж., Оутен М.Дж., Фрэнсис Х.М. Четырехдневное диетическое вмешательство в западном стиле вызывает снижение гиппокампально-зависимого обучения, памяти и интероцептивной чувствительности. PLoS ONE. 2017; 12: e0172645.

    PubMed PubMed Central Google ученый

  • 112.

    Fernstrom JD. Взгляд на безопасность дополнительного триптофана, основанный на его метаболической судьбе. J Nutr. 2016; 146: 2601С – 8С.

    CAS PubMed Google ученый

  • 113.

    Руссо С., Кема И. П., Боскер Ф., Хаавик Дж., Корф Дж. Триптофан как эволюционно законсервированный сигнал серотонину мозга: молекулярные доказательства и психиатрические последствия. World J Biol Psychiatry. 2009. 10: 258–68.

    PubMed Google ученый

  • 114.

    Cervenka I, Agudelo LZ, Ruas JL. Кинуренины: метаболиты триптофана при физических упражнениях, воспалениях и психическом здоровье. Наука. 2017; 357: 6349.

    Google ученый

  • 115.

    Pu J, Liu Y, Zhang H, Tian L, Gui S, Yu Y, Chen X, Chen Y, Yang L, Ran Y, Zhong X. Интегрированный мета-анализ метаболитов периферической крови и биологических функции при большом депрессивном расстройстве. Молекулярная психиатрия. 2020: 1-2.

  • 116.

    Лавлейс, доктор медицины, Варни Б., Сундарам Дж., Леннон М.Дж., Лим С.К., Джейкобс К. и др.Недавние доказательства расширенной роли кинуренинового пути метаболизма триптофана в неврологических заболеваниях. Нейрофармакология. 2017; 112: 373–88.

    CAS PubMed Google ученый

  • 117.

    О’Фаррелл К., Харкин А. Стресс-зависимая регуляция кинуренинового пути: отношение к нейропсихиатрическим и дегенеративным расстройствам. Нейрофармакология. 2017; 112: 307–23.

    PubMed Google ученый

  • 118.

    Штрассер Б., Беккер К., Фукс Д., Гостнер Дж. М.. Метаболизм кинуренинового пути и активация иммунной системы: периферические измерения при психиатрических и сопутствующих заболеваниях. Нейрофармакология. 2017; 112: 286–96.

    CAS PubMed Google ученый

  • 119.

    Агус А., Планше Дж., Сокол Х. Регуляция метаболизма триптофана кишечной микробиотой при здоровье и болезнях. Клеточный микроб-хозяин. 2018; 23: 716–24.

    CAS PubMed Google ученый

  • 120.

    Roager HM, Licht TR. Микробные катаболиты триптофана в здоровье и болезнях. Nat Commun. 2018; 9: 3294.

    PubMed PubMed Central Google ученый

  • 121.

    Lukic I, Getselter D, Koren O, Elliott E. Роль триптофана в вызванном микробиотой депрессивном поведении: данные исследования истощения триптофана. Front Behav Neurosci. 2019; 13: 123.

    CAS PubMed PubMed Central Google ученый

  • 122.

    Badawy AA. Доступность триптофана для метаболизма кинуренинового пути на протяжении всей жизни: механизмы контроля и акцент на старении, физических упражнениях, диете и пищевых добавках. Нейрофармакология. 2017; 112: 248–63.

    CAS PubMed Google ученый

  • 123.

    Fernstrom JD. Эффекты и побочные эффекты, связанные с употреблением триптофана без пищевых продуктов. J Nutr. 2012; 142: 2236С – 44С.

    CAS PubMed Google ученый

  • 124.

    Wirleitner B, Schroecksnadel K, Winkler C, Schennach H, Fuchs D. Ресвератрол подавляет индуцированные интерфероном-γ биохимические пути в мононуклеарных клетках периферической крови человека in vitro. Immunol Lett. 2005; 100: 159–63.

    CAS PubMed Google ученый

  • 125.

    Долпади Дж., Сорини С., Ди Пьетро С., Косорич И., Феррарез Р., Сайта Д. и др. Пероральный пробиотик VSL # 3 предотвращает аутоиммунный диабет, модулируя микробиоту и стимулируя толерогенную кишечную среду, обогащенную индоламином-2,3-диоксигеназой.J Diabetes Res. 2016; 2016: 7569431.

    PubMed Google ученый

  • 126.

    Jeong YI, Kim SW, Jung ID, Lee JS, Chang JH, Lee CM и др. Куркумин подавляет индукцию индоламин-2, 3-диоксигеназы, блокируя сигнальный путь Янус-активированная киназа-протеинкиназа Cδ-STAT1 в дендритных клетках мышей, стимулированных интерфероном-γ. J Biol Chem. 2009. 284: 3700–8.

    CAS PubMed Google ученый

  • 127.

    Мин SY, Ян М., Ким С.Б., Равикумар С., Квон С.Р., Ванарса К. и др. Эпигаллокатехин-3-галлат зеленого чая подавляет аутоиммунный артрит через дендритные клетки, экспрессирующие индоламин-2, 3-диоксигеназу, и ядерный фактор, эритроидный 2-подобный 2 антиоксидантный путь. J Inflamm. 2015; 12: 1–15.

    Google ученый

  • 128.

    Heischmann S, Gano LB, Quinn K, Liang LP, Klepacki J, Christians U, et al. Регулирование метаболизма кинуренина с помощью кетогенной диеты.J Lipid Res. 2018; 59: 958–66.

    CAS PubMed PubMed Central Google ученый

  • 129.

    Лемье Г.А., Каннингем К.А., Лин Л., Майер Ф., Верб З., Ашрафи К. Кинурениновая кислота — это пищевой сигнал, который обеспечивает пластичность поведения. Клетка. 2015; 160: 119–31.

    CAS PubMed PubMed Central Google ученый

  • 130.

    Штрассер Б., Бергер К., Фукс Д. Влияние диеты с ограничением калорийности веса на метаболизм триптофана и воспалительные биомаркеры у взрослых с избыточным весом.Eur J Nutr. 2015; 54: 101–7.

    CAS PubMed Google ученый

  • 131.

    Гостнер Дж. М., Беккер К., Крофт К. Д., Вудман Р. Дж., Пудди И. Б., Фукс Д. и др. Регулярное употребление черного чая увеличивает концентрацию кинуренина в крови: рандомизированное контролируемое исследование. BBA Clin. 2015; 3: 31–5.

    CAS PubMed Google ученый

  • 132.

    Gualdoni GA, Fuchs D, Zlabinger GJ, Gostner JM.Прием ресвератрола увеличивает активность индоламин-2,3-диоксигеназы у людей. Pharmacol Rep., 2016; 68: 1065–8.

    CAS PubMed Google ученый

  • 133.

    Rezin GT, Amboni G, Zugno AI, Quevedo J, Streck EL. Митохондриальная дисфункция и психические расстройства. Neurochem Res. 2009; 34: 1021.

    CAS PubMed Google ученый

  • 134.

    Filler K, Lyon D, Bennett J, McCain N, Elswick R, Lukkahatai N, et al.Ассоциация митохондриальной дисфункции и усталости: обзор литературы. BBA Clin. 2014; 1: 12–23.

    PubMed PubMed Central Google ученый

  • 135.

    Wang Y, Ni J, Gao C, Xie L, Zhai L, Cui G, et al. Трансплантация митохондрий снижает депрессивное поведение, вызванное липополисахаридами. Prog Neuro-Psychopharmacol Biol Psychiatry. 2019; 93: 240–9.

    CAS Google ученый

  • 136.

    Серджи Д., Наумовски Н.Н., Хайльбронн ЛХК, Абейвардена М., О’Каллаган Н., Лионетти Л. и др. Митохондриальная (дис) функция и инсулинорезистентность: от патофизиологических молекулярных механизмов до влияния диеты. Front Physiol. 2019; 10: 532.

    PubMed PubMed Central Google ученый

  • 137.

    Kuipers EN, Held NM, in het Panhuis W, Modder M, Ruppert PM, Kersten S, et al. Один день кормления с высоким содержанием жиров вызывает накопление липидов и инсулинорезистентность в коричневой жировой ткани у мышей.Am J Physiol Endocrinol Metab. 2019; 317: E820–30.

    CAS PubMed Google ученый

  • 138.

    Марин-Ройо Г., Родригес К., Ле Папе А., Хурадо-Лопес Р., Луасес М., Антекера А. и др. Роль митохондриального окислительного стресса в метаболических изменениях при ожирении, вызванном диетой, у крыс. FASEB J. 2019; 33: 12060–72.

    PubMed PubMed Central Google ученый

  • 139.

    Ян Х-Х, Ван Х, Ши Т-Т, Донг Дж.-К, Ли Ф-Дж, Цзэн Л-Х и др. Дисфункция митохондрий при неалкогольной жировой болезни печени, вызванной диетой с высоким содержанием жиров: смягчающий эффект и его механизм Polygonatum kingianum. Biomed Pharmacother. 2019; 117: 109083.

    CAS PubMed Google ученый

  • 140.

    Sihali-Beloui O, Aroune D, Benazouz F, Hadji A, El-Aoufi S, Marco S. Гиперкалорийная диета вызывает окислительный стресс печени, инфильтрацию лимфоцитов и митохондриальные перестановки в модели Psammomys obesus, мышиной модели. инсулинорезистентности.C R Biol. 2019; 342: 209–19.

    PubMed Google ученый

  • 141.

    Woodman AG, Mah R, Keddie DL, Noble RM, Holody CD, Panahi S, et al. Перинатальный дефицит железа и диета с высоким содержанием соли вызывают долговременную дисфункцию митохондрий почек и окислительный стресс. Cardiovasc Res. 2020; 116: 183–92.

    CAS PubMed Google ученый

  • 142.

    Фери Дж. Л., Будурес А. Л., Рид М., Друри А., Шеаффер С., Моди З. и др.Диета матери с высоким содержанием жиров и сахарозы вызывает трансгенеративную сердечную митохондриальную дисфункцию независимо от материнской митохондриальной наследования. Am J Physiol Heart Circ Physiol. 2019; 316: h2202–10.

    CAS PubMed PubMed Central Google ученый

  • 143.

    Меньшикова Е.В., Ритов В.Б., Дубе Дж. Дж., Амати Ф., Стефанович-Рачич М., Толедо Ф.Г. и др. Потеря веса и физические упражнения, вызванные ограничением калорий, по-разному влияют на митохондрии скелетных мышц, несмотря на схожее влияние на чувствительность к инсулину.Журнал Геронтол Сер А. 2018; 73: 81–7.

    CAS Google ученый

  • 144.

    Хэнкок С.Р., Хан Д.Х., Хигашида К., Ким С.Х., Холлоши Дж. Стимулирует ли ограничение калорий биогенез митохондрий? Переоценка. FASEB J. 2011; 25: 785–91.

    CAS PubMed PubMed Central Google ученый

  • 145.

    Brietzke E, Mansur RB, Subramaniapillai M, Balanzá-Martínez V, Vinberg M, González-Pinto A, et al.Кетогенная диета как метаболическая терапия расстройств настроения: доказательства и разработки. Neurosci Biobehav Rev.2018; 94: 11–6.

    CAS PubMed Google ученый

  • 146.

    Салливан П.Г., Риппи Н.А., Доренбос К., Консепсьон Р.К., Агарвал А.К., Ро Дж. М.. Кетогенная диета увеличивает уровни и активность митохондриального разобщающего белка. Энн Нейрол. 2004; 55: 576–80.

    CAS PubMed Google ученый

  • 147.

    Кокко Т., Сгоббо П., Клементе М., Лоприоре Б., Граттаглиано И., Ди Паола М. и др. Тканевые изменения митохондриальных функций у старых крыс: эффект длительного диетического лечения с N-ацетилцистеином. Free Radic Biol Med. 2005; 38: 796–805.

    CAS PubMed Google ученый

  • 148.

    Timmers S, Konings E, Bilet L, Houtkooper RH, van de Weijer T, Goossens GH, et al. Эффекты 30-дневного приема ресвератрола на энергетический метаболизм и метаболический профиль у людей с ожирением, похожие на ограничение калорий.Cell Metab. 2011; 14: 612–22.

    CAS PubMed Google ученый

  • 149.

    Кавалли Дж., Херд Э. Достижения в области эпигенетики связывают генетику с окружающей средой и болезнями. Природа. 2019; 571: 489–99.

    CAS PubMed Google ученый

  • 150.

    Ли М., Д’Арси К., Ли Х, Чжан Т., Джубер Р., Мэн Х. Что исследования метилирования ДНК говорят нам о депрессии? Систематический обзор.Перевод психиатрии. 2019; 9: 1–14.

    Google ученый

  • 151.

    Bressler J, Marioni RE, Walker RM, Xia R, Gottesman RF, Windham BG, Grove ML, Guan W., Pankow JS, Evans KL, Mcintosh AM. Эпигенетическое ускорение возраста и когнитивная функция у взрослых афроамериканцев в среднем возрасте: исследование риска атеросклероза в сообществах. Журналы геронтологии: Серия А. 2020; 75 (фев): 473–80.

    Google ученый

  • 152.

    Розен А.Д., Робертсон К.Д., Хлэди Р.А., Мюнч К., Ли Дж., Филиберт Р. и др. Возраст метилирования ДНК ускоряется при алкогольной зависимости. Перевод Психиатрия. 2018; 8: 182.

    PubMed PubMed Central Google ученый

  • 153.

    Фрайз Г.Р., Бауэр И.Е., Скаини Дж., Валвассори С.С., Уолсс-Басс К., Соарес Дж. К., Кеведо Дж. Ускоренное биологическое старение гиппокампа при биполярном расстройстве. Биполярные расстройства. 2020; 22 (август): 498–507.

    CAS PubMed Google ученый

  • 154.

    Дэвис Э.Г., Хамфрис К.Л., МакИвен Л.М., Саккет М.Д., Камачо М.К., MacIsaac JL и др. Возраст ускоренного метилирования ДНК у девочек-подростков: ассоциации с повышенным суточным кортизолом и сниженным объемом гиппокампа. Перевод Психиатрия. 2017; 7: e1223.

    CAS PubMed PubMed Central Google ученый

  • 155.

    Voisey J, Lawford BR, Morris CP, Wockner LF, Noble EP, Young RM, et al. Эпигенетический анализ подтверждает отсутствие ускоренного старения мозга при шизофрении.NPJ Schizophr. 2017; 3: 26.

    PubMed PubMed Central Google ученый

  • 156.

    Chen L, Dong Y, Bhagatwala J, Raed A, Huang Y, Zhu H. Влияние добавок витамина D3 на эпигенетическое старение афроамериканцев с избыточным весом и ожирением с субоптимальным статусом витамина D: рандомизированное клиническое испытание. J Gerontol A Biol Sci Med Sci. 2019; 74: 91–8.

    CAS PubMed Google ученый

  • 157.

    Stubbs TM, Bonder MJ, Stark AK, Krueger F, Team BIAC, von Meyenn F, et al. Предиктор возраста метилирования ДНК различных тканей у мышей. Genome Biol. 2017; 18:68.

  • 158.

    Сае-Ли К., Корси С., Барроу TM, Кунле ГГК, Боллати В., Матерс Дж. С. и др. Диетическое вмешательство изменяет возраст метилирования ДНК, оцениваемый по эпигенетическим часам. Mol Nutr Food Res. 2018; 62: e1800092.

    PubMed Google ученый

  • 159.

    О’Нил А., Ициопулос С., Скутерис Х., Опи Р.С., Макфи С., Хилл Б. и др.Профилактика проблем с психическим здоровьем у потомства путем целенаправленного питания беременных женщин. BMC Med. 2014; 12: 208.

    PubMed PubMed Central Google ученый

  • 160.

    Mill J, Heijmans BT. От обещаний к практическим стратегиям в эпигенетической эпидемиологии. Nat Rev Genet. 2013; 14: 585–94.

    CAS PubMed Google ученый

  • 161.

    Бьянко-Миотто Т., Крейг Дж.М., Гассер Ю.П., ван Дейк С.Дж., Озанн С.Е.Эпигенетика и DOHaD: от основ до рождения и далее. J Dev Orig Health Dis. 2017; 8: 513–9.

    CAS PubMed Google ученый

  • 162.

    Чой С.В., Фризо С. Эпигенетика: новый мост между питанием и здоровьем. Adv Nutr. 2010; 1: 8–16.

    CAS PubMed PubMed Central Google ученый

  • 163.

    Ремели М., Стефанска Б., Ловречич Л., Магнит U, Хаслбергер АГ.Нутриэпигеномика: роль питания в эпигенетическом контроле заболеваний человека. Curr Opin Clin Nutr Metab Care. 2015; 18: 328–33.

    CAS PubMed Google ученый

  • 164.

    Heijmans BT, Tobi EW, Stein AD, Putter H, Blauw GJ, Susser ES, et al. Стойкие эпигенетические различия, связанные с пренатальным воздействием голода у людей. Proc Natl Acad Sci USA. 2008; 105: 17046–9.

    CAS PubMed Google ученый

  • 165.

    Баркер Э.Д., Уолтон Э., Сесил КАМ. Ежегодный обзор исследования: метилирование ДНК как посредник в связи между подверженностью риску и детской и подростковой психопатологией. J Детская психическая психиатрия. 2018; 59: 303–22.

    PubMed Google ученый

  • 166.

    Питер С.Дж., Фишер Л.К., Кундакович М., Гарг П., Яковцевски М., Динсер А. и др. Признаки метилирования ДНК при недоедании в раннем детстве, связанном с нарушениями внимания и познания.Биол Психиатрия. 2016; 80: 765–74.

    CAS PubMed PubMed Central Google ученый

  • 167.

    Макгоуэн П.О., Миней М.Дж., Шиф М. Диета и эпигенетическое (ре) программирование фенотипических различий в поведении. Brain Res. 2008; 1237: 12–24.

    CAS PubMed PubMed Central Google ученый

  • 168.

    Burdge GC, Lillycrop KA. Питание, эпигенетика и пластичность развития: значение для понимания болезней человека.Annu Rev Nutr. 2010; 30: 315–39.

    CAS PubMed Google ученый

  • 169.

    Gomez-Pinilla F, Yang X. Подход системной биологии, пересекающий диету и клеточный метаболизм с патогенезом заболеваний головного мозга. Prog Neurobiol. 2018; 169: 76–90.

    CAS PubMed PubMed Central Google ученый

  • 170.

    Ремели М., Ловречич Л., де ла Гарса А.Л., Мильоре Л., Петерлин Б., Милагро ФИ и др.Терапевтические перспективы эпигенетически активных веществ. Br J Pharmacol. 2015; 172: 2756–68.

    CAS PubMed Google ученый

  • 171.

    Гонсалес-Бесерра К., Рамос-Лопес О., Баррон-Кабрера Е., Риезу-Бой Дж. И., Милагро Ф. И., Мартинес-Лопес Е. и др. Жирные кислоты, эпигенетические механизмы и хронические заболевания: систематический обзор. Lipids Health Dis. 2019; 18: 178.

    CAS PubMed PubMed Central Google ученый

  • 172.

    Qin Y, Wade PA. Пересечение микробиома и эпигенома: сообщения от ошибок. J Biochem. 2018; 163: 105–12.

    CAS PubMed Google ученый

  • 173.

    Агусти А., Гарсиа-Пардо М.П., ​​Лопес-Альмела I, Кампильо I, Маес М., Романи-Перес М. и др. Взаимодействие между осью кишечник-мозг, ожирением и когнитивными функциями. Front Neurosci. 2018; 12: 155.

    PubMed PubMed Central Google ученый

  • 174.

    Luppino FS, de Wit LM, Bouvy PF, Stijnen T, Cuijpers P, Penninx BW и др. Избыточный вес, ожирение и депрессия: систематический обзор и метаанализ продольных исследований. Arch Gen Psychiatry. 2010; 67: 220–9.

    PubMed Google ученый

  • 175.

    Mansur RB, Brietzke E, McIntyre RS. Есть ли «синдром метаболического настроения»? Обзор взаимосвязи между ожирением и расстройствами настроения. Neurosci Biobehav Rev.2015; 52: 89–104.

    PubMed Google ученый

  • 176.

    Даллман М.Ф., Пекораро Н., Акана С.Ф., Ла Флер С.Е., Гомес Ф., Хаушьяр Х. и др. Хронический стресс и ожирение: новый взгляд на «комфортную пищу». Proc Natl Acad Sci USA. 2003; 100: 11696–701.

    CAS PubMed Google ученый

  • 177.

    Bornstein SR, Schuppenies A, Wong ML, Licinio J. Подход к общей биологии ожирения и депрессии: ось стресса как локус взаимодействия генов и окружающей среды.Мол Психиатрия. 2006; 11: 892–902.

    CAS PubMed Google ученый

  • 178.

    Schachter J, Martel J, Lin CS, Chang CJ, Wu TR, Lu CC, et al. Влияние ожирения на депрессию: роль воспаления и микробиоты кишечника. Иммунное поведение мозга. 2018; 69: 1–8.

    CAS PubMed Google ученый

  • 179.

    Miller GE, Freedland KE, Carney RM, Stetler CA, Banks WA.Пути, связывающие депрессию, ожирение и воспалительные маркеры у здоровых молодых людей. Иммунное поведение мозга. 2003. 17: 276–85.

    CAS PubMed Google ученый

  • 180.

    Ману П., Хан С., Радхакришнан Р., Расс М. Дж., Кейн Дж. М., Коррелл К. У. Индекс массы тела идентифицирован как независимый предиктор повторной госпитализации в психиатрическую больницу. J Clin Psychiatry. 2014; 75: e573–7.

    PubMed Google ученый

  • 181.

    Bellavia A, Centorrino F, Jackson JW, Fitzmaurice G, Valeri L. Роль увеличения веса в объяснении эффектов нейролептиков на положительные и отрицательные симптомы: анализ исследования шизофрении CATIE. Schizophr Res. 2019; 206: 96–102.

    PubMed Google ученый

  • 182.

    Fontana L, Meyer TE, Klein S, Holloszy JO. Долгосрочное ограничение калорий очень эффективно снижает риск атеросклероза у людей.Proc Natl Acad Sci USA. 2004. 101: 6659–63.

    CAS PubMed Google ученый

  • 183.

    Рицца В., Веронезе Н., Фонтана Л. Какова роль ограничения калорий и качества диеты в обеспечении здорового долголетия? Aging Res Rev.2014; 13: 38–45.

    PubMed Google ученый

  • 184.

    Jebeile H, Gow ML, Baur LA, Garnett SP, Paxton SJ, Lister NB. Связь лечения детского ожирения, включая диетический компонент, с депрессией и тревогой: систематический обзор и метаанализ.JAMA Pediatr. 2019; 173: e1.

    PubMed Central Google ученый

  • 185.

    Jacka FN, Mykletun A, Berk M, Bjelland I, Tell GS. Связь между качеством привычного питания и распространенными психическими расстройствами у взрослых, проживающих в сообществах: исследование Hordaland Health. Psychosom Med. 2011; 73: 483–90.

    PubMed Google ученый

  • 186.

    Mezuk B, Eaton WW, Albrecht S, Golden SH.Депрессия и диабет 2 типа на протяжении жизни: метаанализ. Уход за диабетом. 2008; 31: 2383–90.

    PubMed PubMed Central Google ученый

  • 187.

    Huffman JC, Celano CM, Beach SR, Motiwala SR, Januzzi JL. Депрессия и болезни сердца: эпидемиология, механизмы и диагностика. Cardiovasc Psychiatry Neurol. 2013; 2013: 695925.

    PubMed PubMed Central Google ученый

  • 188.

    Юнг С.Дж., Ву Х.Т., Чо С. и др. Связь между размером тела, изменением веса и депрессией: систематический обзор и метаанализ. Br J Psychiatry. 2017; 211: 14–21.

    PubMed Google ученый

  • 189.

    Пауэр М.Л., Шулькин Дж. Половые различия в хранении жира, жировом обмене и рисках для здоровья от ожирения: возможные эволюционные истоки. Br J Nutr. 2008; 99: 931–40.

    CAS PubMed PubMed Central Google ученый

  • 190.

    Кифер И., Ратманнер Т., Кунце М. Различия в питании и диете у мужчин и женщин. J Men’s Health Gend. 2005; 2: 194–201.

    Google ученый

  • 191.

    Buening-Fesel M, Rueckert-John J. Почему мужчины едят так, как они едят?: Соображения с точки зрения питания и гендерной социологии. Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz. 2016; 59: 950–6.

    Google ученый

  • 192.

    Wardle J, Haase AM, Steptoe A, Nillapun M, Jonwutiwes K, Bellisie F. Гендерные различия в выборе продуктов питания: вклад веры в здоровье и диеты. Ann Behav Med. 2004. 27: 107–16.

    PubMed Google ученый

  • Молекулярное питание — CABI.org

    Описание

    Молекулярное питание (изучение взаимодействия между питательными веществами и различными внутриклеточными и внеклеточными молекулами) — одна из наиболее быстро развивающихся областей науки о питании.В конечном итоге исследования молекулярного питания покажут, как питательные вещества могут влиять на фундаментальные процессы, такие как восстановление ДНК, пролиферация клеток и апоптоз. Эта книга — единственный доступный полный том, посвященный молекулярному питанию. Он содержит статьи ведущих международных экспертов и обзоры наиболее важных и последних исследований в различных областях молекулярного питания.

    Содержание

    • Часть 1: Методы исследования молекулярного питания
    • 1: Геномика и не только,
    • 2: Перспективы исследований постгеномного питания,
    • Часть 2: Гомеостаз клеточных питательных веществ, пролиферация и апоптоз
    • 3: Молекулярная физиология плазматической мембраны переносчики органических питательных веществ,
    • 4: Внутриклеточное перемещение и компартментализация витаминов и их физиологически активных форм,
    • 5: Гомеостаз питательных веществ в пролиферирующих клетках,
    • 6: Питательные вещества и апоптоз,
    • Часть 3: Роли питательных веществ в передаче сигналов , Экспрессия генов и протеолиз
    • 7: Глюкозная регуляция экспрессии генов у млекопитающих,
    • 8: Аминокислотный контроль транскрипции в клетках млекопитающих,
    • 9: Жирные кислоты и экспрессия генов,
    • 10: Роли RAR и RXR в опосредовании молекулярного механизма действия витамина A,
    • 11: Регуляция экспрессии гена b y биотин, витамин B6 и витамин C,
    • 12: Селен и витамин E,
    • 13: Сфинголипиды: новая стратегия лечения и профилактики рака,
    • 14: Влияние на здоровье диетических изофлавонов,
    • 15: Механизмы убиквитинирование и протеасомозависимый протеолиз в скелетных мышцах,
    • Часть 4: Нуклеиновые кислоты и соединения, связывающие нуклеиновые кислоты
    • 16: Диета, метилирование ДНК и рак,
    • 17: Биотинилирование гистонов в клетках человека,
    • 18: Ниацин статус, поли (АДФ-рибоза) метаболизм и геномная нестабильность,
    • Часть 5: Молекулярные события, влияющие на физиологию
    • 19: Сборка триглицеридов, транспортирующих липопротеины плазмы,
    • 20: Регулирование клеточного холестерина,
    • 21: 2002 Оценка питания Влияние на риск катаракты,
    • 22: Питание и иммунная функция,
    • Часть 6: Продукты питания
    • 23: Молекулярные механизмы пищевой аллергии,
    • 24 : Оценка безопасности генетически модифицированных пищевых продуктов,

    Отзывы

    Следует поздравить редакторов с выбором экспертов, которые внесли важный вклад в улучшение нашего понимания того, как питательные вещества и микронутриенты могут оказывать свое влияние на живые клетки и организмы. Molecular Nutrition представляет собой важный справочник для студентов и экспертов, заинтересованных в получении ответов на вопрос, «как работают питательные вещества». Кишорчандра Гохил, Американский журнал биологии человека, 16 (6), 2004 г. «Книга должна быть составной частью библиотеки и учебной программы каждого диетолога». S. H Zeisel, Американский журнал клинического питания, 2004 г., 79 «Книга решила почти невозможную задачу по сжатию основных аспектов молекулярного питания.Он написан ясным и понятным стилем, что делает его ценным введением в эту очень важную тему для всех, кто интересуется или работает в области молекулярного питания. Я обязательно сохраню копию на моей книжной полке » Асим К. Дуттарой, Скандинавский младший специалист по питанию 2003 47 (4)

    Молекулярная аннотация пищевых продуктов — на пути к индивидуальной диете и точному здоровью

    https://doi.org/10.1016/j.tifs.2019.07.016Получить права и контент

    Основные моменты

    Научно-технический прогресс ускоряет прогресс в направлении точности здоровье.

    Нутригенетика и нутригеномика учитывают индивидуальные вариации.

    Сложность диеты и питания до конца не осознается.

    Представлена ​​структура для аннотирования молекулярных свойств пищевых продуктов.

    Современные технологии могут применяться для персонализированного управления питанием и здоровьем.

    Аннотация

    Общие сведения

    Персонализированная диета требует соответствия генотипических и фенотипических характеристик человека продуктам, которые увеличивают шанс достижения желаемого физиологического результата для здоровья.Новые идеи и технологии помогут разобраться в тонкостях взаимоотношений диеты и здоровья и создать возможности для прорыва в диетических вмешательствах для управления личным здоровьем.

    Объем и подход

    В этой статье описывается научный прогресс в направлении персонализированного питания и указывается на необходимость интеграции высококачественных данных о продуктах питания. Представлена ​​схема молекулярной аннотации пищевых продуктов с акцентом на то, какие аспекты следует измерять и как эти меры связаны со здоровьем.Обсуждаются стратегии применения современных технологий для улучшения персонализированного питания и здоровья, выделяются проблемы и возможности для преобразования данных в идеи и действия.

    Основные выводы и выводы

    Цель персонализированного питания — дать возможность людям и лицам, осуществляющим уход, принимать обоснованные диетические решения для целевого управления здоровьем. Достижение этой цели требует лучшего понимания того, как молекулярные свойства пищи влияют на индивидуальное пищевое поведение и результаты для здоровья.Аннотирование пищи на молекулярном уровне включает описание ее химического состава и модификаций, физико-химической структуры и биологических свойств. Особенности молекулярных свойств в структуре пищевых аннотаций применимы к различным условиям и процессам, от сырья до блюд. Применение современных технологий, таких как методы омики, носимые биосенсоры и искусственный интеллект, будет поддерживать сбор данных, анализ данных и персонализированные диетические действия для целевого управления здоровьем.

    Ключевые слова

    Диета

    Еда

    Персонализированное питание

    Здоровье

    Молекулярные свойства

    Данные

    Рекомендуемые статьи Цитирующие статьи (0)

    Полный текст

    © 2019 Издано Elsevier Ltd.

    Рекомендуемые статьи

    статьи

    Влияние диеты сельди на метаболизм стеролов и белковый обмен у мышей

    Аннотация

    Фон

    Изменения в образе жизни привели к эпидемическому развитию заболеваний, связанных с ожирением, которые бросают вызов системам здравоохранения во всем мире.При разработке стратегий решения этой проблемы основное внимание уделяется диете для предотвращения развития заболеваний, связанных с ожирением, таких как сердечно-сосудистые заболевания (ССЗ). Для этого потребуются методы, связывающие потребление питательных веществ с конкретными метаболическими процессами в различных тканях.

    Методология / основной вывод

    Мышей с дефицитом рецепторов липопротеинов низкой плотности ( Ldlr — / -) давали диету с высоким содержанием жиров и сахара, имитирующую западную диету, что является основной причиной развития ожирения и атеросклероза.В рацион добавлялись говядина или сельдь, а содержание макроэлементов соответствовало. Измеряли состав тела, липиды плазмы и площади поражения аорты. Транскриптомы метаболически важных тканей, например Печень, мышцы и жировая ткань были проанализированы с помощью комплексного подхода с метаболическими сетями для прямого картирования метаболических эффектов диеты в этих различных тканях. Наш анализ выявил снижение метаболизма стеролов и белкового обмена на уровне транскрипции у мышей, получавших сельдь.

    Заключение

    Это исследование показывает, что интегрированный анализ данных транскриптома с использованием метаболических сетей привел к идентификации сигнатурных путей. Этого нельзя было достичь стандартными методами кластеризации. В частности, этот анализ системной биологии может обогатить информационное содержание биомедицинских данных или данных о питании, где тонкие изменения в нескольких тканях вместе влияют на метаболизм тела или прогрессирование заболевания. Это может быть применено для улучшения диеты для субъектов, подвергающихся риску для здоровья, связанному с ожирением.

    Образец цитирования: Nookaew I, Gabrielsson BG, Holmäng A, Sandberg A-S, Nielsen J (2010) Идентификация молекулярных эффектов диеты с помощью системной биологии: влияние диеты из сельди на метаболизм стеролов и обмен белков у мышей. PLoS ONE 5 (8): e12361. https://doi.org/10.1371/journal.pone.0012361

    Редактор: Иммо А. Хансен, Государственный университет Нью-Мексико, Соединенные Штаты Америки

    Поступила: 9 февраля 2010 г .; Принято к печати: 6 июля 2010 г .; Опубликовано: 24 августа 2010 г.

    Авторские права: © 2010 Nookaew et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа получила финансовую поддержку от Национального совета рыболовства Швеции (Структурные фонды ЕС), Фонда Чалмерса и Фонда Кнута и Алисы Валленбергов, Фонда Ново Нордиск, Шведского совета медицинских исследований (проект №12206), Исследовательский фонд Шведской диабетической ассоциации, федеральное правительство Швеции в рамках соглашения LUA / ALF и регион Вестра-Гёталанд. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили, что никаких конкурирующих интересов не существует.

    Введение

    Более 40% взрослых в США страдают ожирением, и ожидается, что к 2030 году около 200 миллионов человек (что соответствует примерно 33%) в Европе будут страдать ожирением.У многих из них разовьется дислипидемия, гипертония и непереносимость глюкозы, что повлечет за собой увеличение затрат для систем здравоохранения. Эти расстройства, связанные с ожирением, в основном вызваны малоподвижным образом жизни и переходом на высококалорийную пищу с высоким содержанием рафинированных углеводов и насыщенных жиров. Поэтому представляет интерес определить стратегии питания, которые могли бы снизить распространенность этих расстройств, поскольку это сместило бы акцент с лечения на профилактику заболеваний. В настоящее время существует большой интерес к действию изолированных биоактивных пищевых соединений, которые имеют пользу для здоровья, например.грамм. ресвератрол и длинноцепочечные n-3 полиненасыщенные жирные кислоты (LC n-3 ПНЖК) [1], [2]. Несмотря на то, что существует множество исследований механизмов действия таких соединений, трудно перевести или объяснить известные воздействия на здоровье конкретных продуктов питания. Чтобы решить эту проблему, мы разработали новую концепцию анализа данных диетических исследований, напрямую связав потребление конкретной пищи с метаболической активностью в различных тканях. Наш подход заключался в одновременном анализе транскрипционных ответов в трех метаболически важных тканях; печень, мышцы и жировая ткань.Таким образом, мы можем связать реакции на тканевом уровне с метаболическими событиями в организме. Еще одним преимуществом нашего исследования является использование диет, имитирующих западную диету, обычно применяемую в современном обществе, поскольку это позволило нам оценить интегративные эффекты всех компонентов в типичных блюдах. Обзор концепции показан на рисунке 1.

    Рис. 1. Чтобы получить молекулярное представление о влиянии диеты на метаболизм в различных тканях, мышей кормили разными диетами под контролем маркронутриентов.

    В исследовании использовали мышей Ldlr — / -, поскольку это позволило оценить, как диета влияет на развитие атеросклероза. Мышей кормили либо диетой на основе говядины (B), либо диетой на основе сельди (H). Вес тела контролировали еженедельно, а в конце исследования измеряли состав тела и выявляли бляшки аорты с помощью гистологического исследования и . Кроме того, были собраны метаболически важные ткани, такие как печень, мышцы и жировая ткань, и на этих образцах был проведен полногеномный анализ транскрипции.После статистического анализа данных, параллельно была проведена стандартная кластеризация и анализ сокращения размеров с целью выявления общих закономерностей в выборках. В комплексном анализе использовались различные типы графов биологических сетей. С помощью этого анализа были идентифицированы конкретные метаболические пути, активируемые в определенных тканях в ответ на диету. Эта информация была объединена с гистологическими данными, чтобы получить новое фундаментальное представление о молекулярном влиянии диеты на обмен веществ в организме.

    https://doi.org/10.1371/journal.pone.0012361.g001

    Наша концепция позволяет напрямую отображать диетические эффекты на молекулярные механизмы в трех тканях по отдельности и путем дальнейшей увязки согласованных диетических эффектов во всех трех тканях вместе взятых, понимание того, как питание влияет на обмен веществ в организме. Ранее предлагалось использовать этот тип интегрированного анализа, чтобы показать, как методология системной биологии может продвинуть нутригеномику [3]. Посредством комплексного анализа, картирования данных транскриптома в метаболических сетях и других типах сетей взаимодействия мы также показываем, что можно идентифицировать полные сигнатуры путей в ответ на диету.Использование профилей транскрипции в сочетании с метаболическими моделями ранее использовалось для идентификации сигнальных путей в дрожжах [4] и в тканях человека [5]. Важным для нашей концепции является то, что мы выполняем комплексный анализ трех основных метаболически важных тканей, поскольку он отражает метаболические реакции всего организма на изменения в диете. Кроме того, этот подход можно легко адаптировать для включения и интеграции измерений в плазме для идентификации биомаркеров, которые отражают конкретную метаболическую активность тканей и которые в конечном итоге могут быть использованы для клинических оценок.

    Результаты

    Опытный образец

    Мы разработали эксперимент, целью которого было оценить влияние диеты на основе сельди и говядины на развитие атеросклероза. Мы использовали мышей с дефицитом рецепторов липопротеинов низкой плотности ( Ldlr — / — ) [6], поскольку эта модель имеет диетическую зависимость от развития атеросклеротических бляшек [7]. Более того, мышь Ldlr — / — восприимчива к ожирению, вызванному диетой, с сопутствующей инсулинорезистентностью [7], [8] и, как таковая, имитирует ситуацию в западном мире.Эпидемиологические исследования показывают, что высокое потребление рыбы с пищей снижает частоту сердечно-сосудистых заболеваний [9], и эти эффекты обычно связывают с длинноцепочечными (LC) n-3 полиненасыщенными жирными кислотами (ПНЖК) [10]. Действительно, предыдущие исследования показывают, что LC n-3 PUFAs, добавленные в диету, снижают образование бляшек и стеатоз печени на модели Ldlr — / — на мышах [10], [11]. Однако влияние потребления рыбы на факторы риска, связанные с сердечно-сосудистыми заболеваниями, ранее не исследовалось на мышах. Это представляет интерес, поскольку рыбный белок снижает уровень липидов в крови у крыс, а также влияет на экспрессию в печени генов, участвующих в метаболизме холестерина [12].Кроме того, недавнее клиническое исследование показало, что комбинированное лечение LC n-3 ПНЖК и таурином, присутствующими в мышцах рыб, было более эффективным в снижении уровня липидов в крови, чем только LC n-3 ПНЖК [13]. В нашем исследовании Ldlr — / — мышей-самцов получали 16-недельную диету с высоким содержанием жиров и сахарозы, дополненную рубленым филе сельди или говяжьим фаршем, чтобы определить метаболические пути, которые были по-разному затронуты в трех тканях, важных для всего организма. метаболизм глюкозы и липидов; печень, скелетные мышцы и белая жировая ткань (WAT).Макроэлементный состав двух диет был идентичным, за исключением источника белка и жира (Таблица S1).

    Фенотипы животных

    Были отобраны три животных из каждой диетической группы для представления всей диетической группы в отношении прибавки в весе, состава тела и уровней липидов в крови (подробности см. В Таблице S2). Уровни общего холестерина и триацилглицеридов в плазме были ниже у мышей, получавших сельдь, по сравнению с мышами, получавшими говядину в оба момента времени (8-я неделя p-значение <0.001 оба; неделя 16 p-значение = 0,017 и 0,002, холестерин и триглицериды соответственно). Состав тела, измеренный на 15 неделе, показал тенденцию к увеличению безжировой массы тела у мышей, получавших сельдь, по сравнению с мышами, получавшими говядину (значение p = 0,050). На 16 неделе площади бляшек на дуге аорты, оцененные с помощью гистологического исследования и , были значительно ниже у мышей, получавших сельдь (p-значение <0,001; 0,6 ± 0,1 по сравнению с 7,4 ± 0,7% площади, сельди и говядина соответственно).

    Первичный анализ данных транскриптома

    Сначала мы выполнили сингулярное разложение (SVD) данных транскриптома, чтобы оценить качество экспериментов с микрочипами (рис. 2A).Как и ожидалось, наибольшее разделение данных было основано на различиях в трех тканях, и влияние ткани маскировало эффект диеты. Тем не менее, в каждой ткани было большое количество генов, экспрессия которых значительно изменилась в ответ на диету (рис. 2В). Это также подтверждается иерархической кластеризацией значительно измененных генов на основе эффекта диеты (текст S1 и рисунок S1). Как видно на рисунке 2B, наиболее отчетливый эффект диеты, то есть самые высокие значения Q по логарифмической шкале, наблюдался в печени, где 344 гена значительно изменили экспрессию.Однако большее количество генов (859) в мышце удовлетворяло пороговому значению Q для значимости менее 0,05. На экспрессию генов в WAT меньше влияла диета, где только 48 генов значительно изменили экспрессию.

    Рисунок 2. Анализ данных транскриптома.

    Для анализа транскриптома отбирали по три мыши из каждой диетической группы. У этих мышей получали печень, мышцы и жировую ткань, из этих тканей выделяли мРНК и анализировали полученные образцы. A. После нормализации было выполнено разложение по одному значению (SVD) данных. Этот анализ указывает на очень четкое разделение трех проанализированных тканей, показывая, что влияние ткани больше, чем эффект диеты, как ожидалось. Анализ SVD указывает на хорошую согласованность между образцами от трех разных мышей, что дает хорошую статистическую мощность для дальнейшего анализа данных. B. Круговой график картирования Q-значений (p-значения, полученные из t-критерия Стьюдента и скорректированные для множественного тестирования) в соответствии с расположением локусов транскрипции на различных хромосомах для каждой из трех тканей.График показывает распределение значений Q в зависимости от диеты. Три меньших графика справа указывают значения Q для трех разных тканей и были наложены на рисунок слева (более подробная информация в тексте S1 и рисунке S6, для простого прямоугольного графика значений Q см. Рисунок S2). C. Для каждой ткани репортерные GO-термины биологического процесса были идентифицированы в соответствии с влиянием диеты. Репортерные GO-термины клеточного компонента и категории молекулярных функций приведены на рисунке S4.Был идентифицирован нормализованный X-балл для всех генов в каждом GO-члене (более подробная информация в тексте S1). Это было сделано для каждой из трех тканей в каждой из двух групп мышей, в результате получилось в общей сложности 6 категорий для каждого GO-члена (3 категории для каждого GO-члена, если рассматривать только фактор тканей, см. Рисунок S3). На рисунке показан X-балл для каждого члена GO. Анализ корректирует размер группы и репортерные термины GO с большим количеством генов, поэтому представляют глобальный ответ, тогда как термины GO с небольшим количеством генов представляют специфические транскрипционные изменения.

    https://doi.org/10.1371/journal.pone.0012361.g002

    Комплексный анализ данных

    Чтобы определить ключевые биологические процессы, на которые влияет диета в печени, скелетных мышцах и WAT, мы выполнили интегрированный анализ с использованием трех биологических сетей для сбора различных уровней информации. Первый анализ дает общее представление о реакции на диету, выявляя важные термины генной онтологии (GO) (рис. 2C). Мы применили алгоритм репортера [4], [14] вместо использования традиционного гипогеометрического теста, поскольку он имеет преимущество в использовании Q-значения для всех транскриптов.Алгоритм репортера позволил идентифицировать ключевые биологические процессы, на которые влияет диета, в трех тканях (Рисунок 2C; для GO «клеточный компонент» и «молекулярная функция» см. Рисунок S4). В печени биологические процессы ГО, на которые повлияла диета, были связаны с метаболизмом липидов / стеролов, например «Процесс биосинтеза липидов» (99 транскриптов), «процесс биосинтеза стеролов» (25 транскриптов) и «процесс биосинтеза холестерина» (23 транскрипта). Точно так же в мышцах и WAT биологическими процессами GO, на которые влияет диета, были трансляция (321 транскрипт, мышца), клеточная адгезия (419 транскриптов, WAT) и защитный ответ на бактерию (77 транскриптов, WAT).Чтобы дополнительно охарактеризовать влияние диеты на метаболизм с помощью репортерного алгоритма [4], [14], мы также определили ключевые метаболиты, используя общую модель метаболизма в масштабе генома (GSMM) для мышей [15], и ключевые процессы Reactome, используя тщательно отобранные доказательства. из базы данных Reactome [16]. На основании этого анализа метаболиты, связанные с биосинтезом жирных кислот / стеролов, были идентифицированы как основные реакции в печени (рис. 3B). Кроме того, в мышцах были идентифицированы специфические биологические процессы, связанные с обменом белков (рис. 4С).Для дальнейшей идентификации молекулярных механизмов, которые запускаются диетой, мы провели скрининг на чрезмерное количество регуляторных мишеней, будь то в промоторных областях или мишенях микроРНК, чтобы определить предполагаемые регуляторные драйверы для ранее идентифицированных изменений. Таким образом, мы смогли идентифицировать известные факторы транскрипции (TF) и микроРНК, которые могли объяснить различия в транскрипции в печени и мышцах, возникающие из-за влияния диеты, как показано на Рисунке 3D и Рисунке S7 (см. Текст S2 для полных результатов).

    Рис. 3. Картирование метаболической активности в печени (зеленый и красный указывают на пониженную и повышенную регуляцию в зависимости от рациона сельди, соответственно).

    A. Обзор генов, участвующих в биосинтезе стеролов и липидов, которые подавляются в ответ на диету сельди. Помимо идентификации ключевых репортерных GO-терминов, также видно, что большинство генов в пути биосинтеза стеролов и жирных кислот подавлены. B. Подавление (панель A) дополнительно подтверждается идентификацией нескольких репортерных метаболитов биосинтеза холестерина и жирных кислот. C. Измерения холестерина и триацилглицерида в плазме. Видно, что уровни обоих понижаются у мышей, получавших диету из сельди, и этот эффект наблюдается как через 8, так и через 16 недель кормления. D. Для всех генов с пониженной регуляцией, идентифицированных в терминах репортерного GO (панель A), был проведен поиск обогащения факторов транскрипции и микроРНК. На тепловой карте показаны идентифицированные факторы транскрипции и микроРНК, а также их матрица совместной встречаемости. Замечено, что большинство регулирующих эффектов обусловлено одним фактором.Для некоторых из идентифицированных факторов транскрипции были идентифицированы соответствующие консенсусные сайты связывания, что привело к идентификации консенсусных сайтов связывания для Srebf ( Srebp ), Hnf4 , Pparg и Ppara . Системы Ppar представляют собой важные активируемые липидами ядерные рецепторы, участвующие в метаболизме липидов и глюкозы; Pparg является важным фактором транскрипции в адипоцитах и ​​Ppara в гепатоцитах. Hnf4a является важным регулятором скоординированного ядерного ответа, опосредованного рецепторами, на ксенобиотики посредством взаимодействия с Cars / Pxr и через Hnf1 , он активирует экспрессию большого количества специфичных для печени генов, включая те, которые участвуют в выработке глюкозы и холестерина. и метаболизм жирных кислот.Наиболее частым сайтом связывания микроРНК является сайт mmu.miR.103, что подразумевает его вклад в ингибирование транскрипции синтеза липидов в печени (см. Текст S1 и рисунок S7).

    https://doi.org/10.1371/journal.pone.0012361.g003

    Рис. 4. Картирование метаболической активности в мышцах (зеленый и красный цвета указывают на пониженную и повышенную регуляцию в зависимости от диеты из сельди, соответственно).

    A. Термины Reporter GO привели к идентификации нескольких ключевых процессов, участвующих в биосинтезе и деградации белка, и гены, связанные с этими процессами, подавляются в ответ на диету сельди.Это указывает на снижение белкового обмена в ответ на диету из сельди. B. Репортерные GO термины также показывают, что имеется подавляющая регуляция генов, связанных с окислительным стрессом и сокращением мышц в ответ на диету из сельди. Это указывает на более эффективное использование энергии, а снижение окислительного стресса может вызвать снижение неправильного свертывания белка и, следовательно, снижение оборота белка. C. Идентификация репортерных процессов Reactome указывает на ту же общую функцию и позволяет идентифицировать даже более специфические процессы, на которые влияет диета, например.грамм. стартовый сайт узнавания и связывания активированных тРНК с рибосомой.

    https://doi.org/10.1371/journal.pone.0012361.g004

    Белая жировая ткань

    Хотя только несколько генов показали значительно измененную экспрессию в WAT, интересно, что на биологический процесс «защитный ответ на бактерию» (GO: 0042742) повлияла диета. В последнее время было обнаружено, что WAT продуцирует ряд связанных с иммунитетом белков, которые обладают паракринными метаболическими функциями, но также могут способствовать повышению плазменных уровней белков острой фазы, связанных с метаболическим синдромом [17].Однако члены этого класса ГО принадлежат преимущественно к семейству дефенсинов, которые представляют собой эволюционно консервативные малые антимикробные пептиды. У Drosophila дефенсины синтезируются в жировом теле и регулируются путем Toll [18]. Роль передачи сигналов Toll-подобных рецепторов при атеросклерозе [19] и диабете 2 типа [20] приобретает все больший интерес, поскольку эти рецепторы, по-видимому, являются связующим звеном между питательными и воспалительными реакциями [21]. Как и в печени, биосинтез холестерина (GO: 0006695) был ниже в WAT у мышей, получавших сельдь, и это могло быть связано с наблюдаемым уменьшением размера адипоцитов у животных, получавших сельдь, поскольку более крупным адипоцитам требуется больше холестерина для капля триацилглицерида [22].

    Печень

    Биологические процессы, на которые повлияла диета в печени, были преимущественно связаны с метаболизмом липидов или стеролов и подавлялись у мышей, получавших сельдевую диету, по сравнению с говяжьей диетой (рис. 3А). Эти биологические процессы включают гены, кодирующие белок, участвующие в удлинении / десатурации жирных кислот и биосинтезе стеролов. Это также нашло отражение в интегрированном анализе данных транскриптома с использованием процессов GSMM или Reactome, где подавляющее большинство идентифицированных метаболитов было связано с биосинтезом n-6 PUFA и, в меньшей степени, n-3 PUFA (рис. 3B).Было слишком много элементов ответа нескольких ТФ, которые являются известными регуляторами метаболических путей липидов / стеролов, а также мишеней микроРНК, особенно семейство mmu-miR-103, которое, как обнаружено, играет заметную роль (рисунок 3D, см. Текст S1 для подробнее). Мы также обнаружили повышенную экспрессию в печени Cyp7a1 как следствие диеты из сельди. Этот ген кодирует ключевой фермент биосинтеза желчных кислот, и это может быть частичным объяснением более низких уровней общего холестерина у мышей, получавших сельдь (рис. 3C).

    Мышца

    Было несколько неожиданных эффектов диеты в скелетных мышцах (рис. 4). У мышей, которых кормили сельдью, наблюдался более низкий обмен белка в скелетных мышцах (рис. 4А). Это отражалось в более низком синтезе белка (обозначенном GO-терминами, связанными с рибосомами и процессами трансляции), более низкой деградации белка (обозначенном GO-терминами, связанными с катаболическим процессом белка посредством убиквитинирования). Это согласуется с анализом процессов Reactome, который показал, что синтез белка, а также деградация были подавлены (рис. 4C).Также наблюдалось снижение экспрессии генов, связанных с сокращением мышц и окислительным фосфорилированием у мышей, получавших сельдь (рис. 4В).

    Модули коэкспрессии генов

    Согласованные диетические эффекты во всех трех тканях были идентифицированы с использованием подхода Zhang et al. [23], а результаты суммированы на фиг. 5. Был идентифицирован один значимый модуль коэкспрессии гена (синий модуль). В этом модуле наиболее прочными связанными функциональными группами были передача сигнала рецептора, связанного с G-белком (GPCR), и передача сигнала кальция через фосфолипазу C (PLC) (светло-зеленые символы; Рисунок 5).PLC катализирует реакцию, приводящую к образованию двух вторых посредников; инозитол-1,4,5-трифосфат (IP3) и диацилглицерин (DAG). IP3 мобилизует внутриклеточный накопленный кальций, в то время как DAG активирует изоформы протеинкиназы C, которые участвуют в регуляторных функциях. Вкусовые и опиоидные рецепторы представляют собой GPCR, тогда как активация рецептора NMDA запускает внутриклеточные события передачи сигналов кальция, включая IP3, DAG и кальмодулин. Меньше соединений было обнаружено в сигнальном пути mTOR (темно-зеленый) и регуляции клеточного морфогенеза (темно-синий).

    Рис. 5. Матрица связности (топологического перекрытия) для генов, наиболее дифференциально экспрессируемых в рационах трех тканей.

    На основе двустороннего анализа ANNOVA было выявлено, что 881 ген значительно реагирует на изменения в диете, и эти гены были использованы для анализа. Строки и столбцы на нижней половине тепловой карты симметрично представляют гены. Сила связности была обозначена интенсивностью цвета, красный — самое сильное соединение, а светло-желтый — отсутствие связи.Синяя цветная полоса обозначает самый высокий модуль взаимосвязанных генов. В прямоугольной рамке изображены функциональные термины, которые показывают значительное обогащение синего модуля. Цвета кружков указывают на один и тот же функциональный модуль.

    https://doi.org/10.1371/journal.pone.0012361.g005

    Обсуждение

    Мыши, получавшие сельдь, имели более низкую потребность в синтезе ПНЖК de novo de novo, поскольку диета содержала избыток этих жирных кислот, но неожиданно наблюдалась пониженная экспрессия генов, участвующих в биосинтезе холестерина и стероидов (рис. 3D).Наши данные показывают, что, несмотря на сопоставимое содержание холестерина в двух диетах, мыши, получавшие сельдь, имели более низкие уровни общего холестерина в плазме, что согласуется с подавлением биосинтеза стеролов (рис. 3C и таблица S2). Однако известно, что эта группа белков транскрипционно регулируется фактором-2, связывающим регуляторный элемент стерола ( Srebf2 ), который активируется за счет отщепления от мембраны эндоплазматического ретикулума (ER) при снижении уровня холестерина в мембране [24]. ].Повышенные уровни PUFA в мембране ER могут влиять на удержание холестерина в этой мембране, что может приводить к снижению активации Srebf2. Также возможно, что эффекты пищевых LC n-3 PUFA на Srebf2 и биосинтез холестерина опосредуются Ppara, как ранее было показано на мышах дикого типа и Ppara — / — [24].

    Наши данные об увеличении клиренса холестерина за счет биосинтеза желчных кислот дополнительно объясняют, почему уровни циркулирующего холестерина были снижены после селедочной диеты, несмотря на одинаковое содержание холестерина в двух диетах.Другие исследования с использованием этой мышиной модели также показали, что уровни холестерина в плазме зависят от липидного состава в рационе [11], [25]. Предполагается, что молекулярные механизмы воздействия LC n-3 PUFA на липидный гомеостаз и атеросклероз у этих мышей включают снижение воспалительной реакции сосудов [25] или нарушение клиренса циркулирующих липопротеинов [26]. Снижение уровней ЛПОНП в плазме было связано с уменьшением атеросклероза у мышей Ldlr — / — [27], что подтверждает последнюю гипотезу.Наши данные предполагают различное влияние диеты на метаболизм липидов в печени, а именно подавление биосинтеза холестерина у мышей, получавших сельдь, и обогащение хиломикронов в печени мышей, получавших говяжье мясо, что отражает нарушенный клиренс циркулирующих частиц липопротеинов у мышей, получавших мясо на основе говядины. диета. Мы предполагаем, что диетическая сельдь улучшает обработку липидов в печени, что приводит к улучшению липидного профиля крови и, как следствие, меньшему образованию бляшек.

    Наши данные о скелетных мышцах согласуются с исследованием, в котором крысы, получавшие рыбий жир, привели к снижению белкового обмена в этой ткани [28].Кроме того, изменения в составе жирных кислот скелетных и сердечных мышц, вызванные потреблением рыбьего жира, повлияли на физические свойства клеточных мембран и, следовательно, на мышечную функцию на модели крыс [29], [30]. Наш анализ показал, что у мышей, получавших сельдь, была более низкая экспрессия генов, связанных с сокращением мышц и окислительным фосфорилированием, по сравнению с мышами, получавшими говядину (рис. 4B). Снижение окислительного фосфорилирования может означать более низкое содержание митохондрий и, следовательно, диетическое воздействие на скелетные мышцы с переключением с волокон типа I на тип II у мышей, получавших сельдь.Это также могло бы объяснить снижение сократимости, которое больше характерно для медленных волокон типа I. Обогащенный анализ регуляторных мотивов выявил чрезмерное количество регуляторных элементов Nrf1 и Mef2 (см. Текст S1 и рисунок S8), которые также поддерживают переключение в типе волокна [31]. Однако в этом контексте интересно отметить, что у мигрирующих птиц пищевые LC n-3 ПНЖК увеличивают окислительную способность мышц в такой же степени, как и тренировки на выносливость [32].Было показано, что у крыс и людей повышенное содержание LC n-3 ПНЖК в клеточных мембранах улучшает эффективность окислительного фосфорилирования, что приводит к увеличению производства энергии в скелетных мышцах [29], [30]. Следовательно, мы предполагаем, что диета на основе сельди приводит к подавлению белкового обмена и, таким образом, уменьшает атрофию, приводящую к увеличению мышечной массы. Кроме того, имелась граничная значимость, показывающая увеличение безжировой массы тела у мышей, получавших сельдь, по сравнению с мышами, получавшими говядину (p-значение = 0.05). Наши результаты также согласуются с клиническими исследованиями, показывающими, что добавление LC n-3 ПНЖК привело к лучшему сохранению массы тела у онкологических больных [33], [34]. Таким образом, наши результаты указывают на функциональное объяснение этих грубых наблюдений.

    Анализ согласованных диетических эффектов на три ткани выявил общую тему, а именно, обработку кальция. Воздействие на обмен белка в скелетных мышцах может быть связано с этим открытием, поскольку нарушение регуляции уровней внутриклеточного кальция считается основной причиной ER-стресса, ведущего к развернутому белковому ответу [35].В скелетных мышцах было высказано предположение, что диетический рыбий жир сохраняет энергетический метаболизм мышечных клеток за счет поддержания саркоплазматического гомеостаза кальция [36]. Изменения в морфогенезе клеток предполагают влияние диеты на ремоделирование тканей. В соответствии с этим, mTOR является сенсором питательных веществ / АТФ, который регулирует пути, контролирующие биогенез рибосом и рост клеток [37]. В частности, в скелетных мышцах mTOR активирует фосфатидилинозитол-3-киназу и события, связанные с внутриклеточным кальцием, влияющие на рост, дифференцировку и выживаемость клеток [38].Эти находки могут иметь отношение к уменьшению образования бляшек у мышей, которых кормили сельдью, поскольку измененная обработка кальция саркоплазматическим ретикулумом в гладкомышечных клетках сосудов, как предполагается, предшествует развитию атеросклеротических поражений у мышей [39].

    В заключение, наш комплексный анализ влияния диеты на метаболическую функцию в различных тканях показывает некоторые очень четкие эффекты, которые имеют значение для развития болезни. Мы предлагаем механистическое объяснение пониженного уровня холестерина в плазме в ответ на диету из сельди, и мы также обнаруживаем, что диета из сельди положительно влияет на обработку белка, что может быть вызвано более низким стрессом ER, что приводит к меньшему неправильному свертыванию белка и, следовательно, к снижению количества белка. оборот.Комплексный анализ данных транскриптома с использованием метаболических сетей привел к идентификации сигнатурных путей / процессов, которые не могли быть обнаружены с помощью стандартной методики кластеризации. Суть нашей концепции состоит в том, чтобы экстраполировать различия в характерных путях / процессах, связать их вместе и объединить это с анализом согласованных эффектов в разных тканях для выявления механизмов, лежащих в основе общих сложных расстройств и эффектов диеты.

    Материалы и методы

    Эксперименты на животных

    Исследование было одобрено местным комитетом по этике животных при Гетеборгском университете, Гетеборг, Швеция.Для этого исследования было выбрано мышей Ldlr / — (текст S1). Семинедельные самцы мышей Ldlr — / — (запас JAX № 002207) были получены от Charles River Laboratories (Зульцфельд, Германия). Мышам давали возможность акклиматизироваться к условиям нашего помещения для животных (постоянная влажность, температура и 12-часовой цикл темнота / свет) в течение одной недели перед началом эксперимента. Мышам давали с высоким содержанием жира / сахарозы с добавлением либо рубленого филе сельди ( Clupea harengus ), либо говяжьего фарша (14 мышей на группу с рационом).Общее содержание жиров и холестерина в двух диетах соответствовало (Таблица S1). Животных держали на диете в течение 16 недель, и еженедельно регистрировали массу тела. На 8 неделе были взяты образцы крови из хвостовой вены и проанализированы на содержание в плазме триглицеридов и уровень общего холестерина с помощью ферментативного анализа с помощью автоанализатора Konelab версии 2.0 (Вантаа, Финляндия). На 15 неделе анестезированных мышей (Isofluran, Baxter, Deerfield, IL, USA) сканировали денситометром Lunar PIXImus (Lunar Corp, Мэдисон, Висконсин, США) для анализа состава тела [40].Мышей умерщвляли передозировкой пентобарбитала натрия на 16 неделе. Аорты вырезали, препарировали и анализировали с помощью гистологического исследования и [41]. Печень, скелетные мышцы (икроножные) и эпидидимальную белую жировую ткань (WAT) замораживали в жидком азоте. Статистический анализ фенотипов выполняли с помощью программного обеспечения SPSS версии 16.0 с использованием U-критерия Манна-Уитни. Значение p менее 0,05 считалось статистически значимым.

    Транскриптомный эксперимент

    Суммарная РНК из печени, скелетных мышц и жировой ткани была выделена у трех выбранных мышей из каждой группы с использованием набора RNeasy Lipid Tissue Mini (печень и WATs; Qiagen, Hilden, Германия) или набора RNeasy Mini (скелетные мышцы; Qiagen). следуя инструкциям производителя.1 мкг общей РНК обрабатывали и гибридизовали на массивах Affymetrix MoGene 1.0 ST (Affymetrix, Санта-Клара, Калифорния, США) в соответствии с Техническим руководством по анализу экспрессии Affymetrix GeneChip (Affymetrix, Санта-Клара, Калифорния, США). кДНК количественно определяли на спектрофотометре, и ее качество оценивали с помощью биоанализатора Agilent 2100 (Agilent Technologies, Waldbronn, Германия) с использованием наборов RNA 6000 Nano LabChip (Agilent Technologies). Станция GeneChip Fluidics Station FS-400 и GeneChip Scanner 3000 7G использовались для гибридизации и сканирования соответственно.Отсканированные изображения (файлы .DAT) были преобразованы в файлы .CEL с помощью программного обеспечения командной консоли (Affymetrix). Файлы CEL использовались для дальнейшего анализа данных.

    Анализ данных транскриптома

    CEL-файлы из всех трех тканей (18 файлов) были нормализованы вместе, чтобы можно было сравнить все значения экспрессии. Сигналы экспрессии обрабатывали методом Probe Logarithmic Intensity Error (PLIER) с квантильной нормализацией [42]. Только идеальный датчик Маха (только PM) использовался для расчета пределов шума и обнаружения.Все данные транскриптома доступны после статистического анализа с использованием теста Стьюдента t и двустороннего дисперсионного анализа с поправкой на множественное тестирование. Параллельно с этим использовались сингулярное разложение (SVD) и стандартный кластерный анализ для выявления общих паттернов транскриптома. Все анализы были выполнены с использованием пакетов R Suite и Bioconductor. См. Более подробную информацию в тексте S1. Все данные транскриптомов доступны на сайте Gene Expression Omnibus (GEO) под номером доступа GSE22532.

    Комплексный анализ

    Статистические значения были нанесены на карту, и алгоритм репортера [4] был применен с использованием трех различных типов биологических сетей, полученных из генных онтологий (GO) [43], метаболической модели в масштабе генома (GSMM) Mus musculus [15] и биологические свидетельства из базы данных Reactome [16] для извлечения биологических ответов в соответствии с влиянием различных диет на каждую конкретную ткань. Многостороннее сравнение выбранных значимых характеристик из предыдущего интегрированного анализа было выполнено и визуализировано в виде тепловых карт X-score (нормализованные накопленные значения экспрессии).Регуляционный анализ был выполнен на основе предсказаний биоинформатики сайтов связывания ТФ и мишеней микроРНК. Статистические значения обогащения сайта связывания / мишени для каждого TF / микроРНК рассчитывали с помощью точного критерия Фишера. Попарное совпадение выбранных сайтов связывания / мишеней было представлено в виде графика половинной тепловой карты. Влияние диеты на мульти-тканевую моду оценивали по дифференциально экспрессируемым генам (на основе Q-значения фактора диеты, полученного из двухфакторного дисперсионного анализа) с помощью сетевого модуля анализа коэкспрессии генов [23].Сильно связанные гены в модуле коэкспрессии дополнительно оценивали их родственные функции с помощью модульного анализа обогащения [44]. Все анализы проводились с использованием пакета R и программного обеспечения Cytoscape [45]. См. Более подробную информацию в тексте S1 и на рисунке S5.

    Дополнительная информация

    Рисунок S1.

    Первичный анализ данных транскриптома. (A) Гистограмма собственных значений каждого собственного компонента, которая указывает на способность захвата относительной дисперсии каждого собственного компонента.(B) График тепловой карты оценок нагрузки каждого собственного компонента. (C) Неконтролируемая иерархическая кластеризация группы значимых генов (значение Q <0,05). Цвета строк столбцов: красный - ВАТ, говяжий рацион; апельсин - ВАТ, селедочная диета; синий - печеночная, говяжья диета; циан - печень, селедочная диета; зеленый - мышечная, говяжья диета; светло-зеленый - мышечная, селедочная диета.

    https://doi.org/10.1371/journal.pone.0012361.s003

    (7,71 МБ TIF)

    Рисунок S3.

    Многосторонняя тепловая карта X-баллов для разных GO в трех разных тканях.ГО были выбраны на основе репортерных значений p <0,001. Цвета ряда столбцов представляют ткань: оранжевый, синий и зеленый относятся к WAT, печени и мышцам соответственно. (A) Биологический процесс, (B) Клеточный компартмент, (C) Молекулярная функция. Количество генов, участвующих в каждом члене GO, указано в дополнительном файле.

    https://doi.org/10.1371/journal.pone.0012361.s005

    (2,51 МБ TIF)

    Рисунок S4.

    Многосторонняя тепловая карта ГО в ответ на диету в различных тканях.ГО были отобраны на основе репортерных p-значений <0,001. Цвета строк столбцов: красный - ВАТ, говяжий рацион; апельсин - ВАТ, селедочная диета; синий - печеночная, говяжья диета; циан - печень, селедочная диета; зеленый - мышечная, говяжья диета; светло-зеленый - мышечная, селедочная диета. (A) Клеточный отсек, (B) Молекулярная функция. Количество генов, участвующих в каждом члене GO, указано в дополнительном файле.

    https://doi.org/10.1371/journal.pone.0012361.s006

    (2,16 МБ TIF)

    Рисунок S5.

    Тепловая карта топологической матрицы перекрытия и ее кластеризация связности.Интенсивность цвета обозначает силу связи между двумя генами, при этом красный цвет представляет самую сильную связь, а светло-желтый — отсутствие связи. Боковые цвета представляют идентифицированные модули.

    https://doi.org/10.1371/journal.pone.0012361.s007

    (0,57 МБ TIF)

    Рисунок S7.

    Кумулятивное распределение изменений для транскриптов, содержащих мишень связывания микроРНК mmu-miR-103 и mmu-miR-107 (зеленая линия), по сравнению с транскриптами без мишени связывания (черная линия).Log2-кратные изменения рассчитывали как отношение средних значений транскрипции мышей, получавших сельдь, и мышей, получавших говядину. Значение p рассчитывается между группой «содержит сайт» и группой «нет сайта» с помощью одностороннего теста Колмогорова-Смирнова (KS)

    .

    https://doi.org/10.1371/journal.pone.0012361.s009

    (0,74 МБ TIF)

    Благодарности

    Благодарим Маргариту Салазар за помощь в анализе массива ДНК.

    Вклад авторов

    Задумал и спроектировал эксперименты: AH ASS JN.Проведены эксперименты: IN BGG. Проанализированы данные: IN BGG. Написал статью: IN BGG JN.

    Ссылки

    1. 1. Ruxton CH, Reed SC, Simpson MJ, Millington KJ (2004) Польза для здоровья полиненасыщенных жирных кислот омега-3: обзор доказательств. J Hum Nutr Diet 17: 449–459.
    2. 2. Baur JA, Sinclair DA (2006) Терапевтический потенциал ресвератрола: доказательства in vivo. Nat Rev Drug Discov 5: 493–506.
    3. 3. Мюллер М., Керстен С. (2003) Нутригеномика: цели и стратегии.Нат Рев Генет 4: 315–322.
    4. 4. Патил К.Р., Нильсен Дж. (2005) Раскрытие транскрипционной регуляции метаболизма с использованием топологии метаболической сети. Proc Natl Acad Sci U S A 102: 2685–2689.
    5. 5. Шломи Т., Кабили М.Н., Херргард М.Дж., Палссон Б.О., Руппин Э. (2008) Сетевое прогнозирование тканеспецифического метаболизма человека. Nat Biotechnol 26: 1003–1010.
    6. 6. Ishibashi S, Goldstein JL, Brown MS, Herz J, Burns DK (1994) Массивный ксантоматоз и атеросклероз у мышей с отрицательным рецептором липопротеинов низкой плотности, получавших холестерин.Дж. Клин Инвест 93: 1885–1893.
    7. 7. Schreyer SA, Vick C, Lystig TC, Mystkowski P, LeBoeuf RC (2002). Дефицит рецептора LDL, но не аполипопротеина E, увеличивает вызванное диетой ожирение и диабет у мышей. Am J Physiol Endocrinol Metab 282: E207–214.
    8. 8. Wu L, Vikramadithyan R, Yu S, Pau C, Hu Y и др. (2006) Добавление диетического жира к холестерину в рационе мышей с нокаутом рецепторов ЛПНП: влияние на инсулин плазмы, липопротеины и атеросклероз.J. Lipid Res. 47: 2215–2222.
    9. 9. Банг Х.О., Дерберг Дж., Синклер Х.М. (1980) Состав пищи эскимосов на северо-западе Гренландии. Am J Clin Nutr 33: 2657–2661.
    10. 10. Сарасвати В., Гао Л., Морроу Д. Д., Чайт А., Нисвендер К. Д. и др. (2007) Рыбий жир увеличивает запасы холестерина в белой жировой ткани с одновременным уменьшением воспаления, стеатоза печени и атеросклероза у мышей. J Nutr 137: 1776–1782.
    11. 11. Замполли А., Бистед А., Лет Т., Мортенсен А., Де Катерина Р. и др.(2006) Контрастное влияние добавок рыбьего жира на развитие атеросклероза на мышиных моделях. Атеросклероз 184: 78–85.
    12. 12. Shukla A, Bettzieche A, Hirche F, Brandsch C, Stangl GI и др. (2006) Пищевой рыбный белок изменяет концентрацию липидов в крови и печеночные гены, участвующие в гомеостазе холестерина в модели на крысах. Британский журнал питания 96: 674–682.
    13. 13. Эльвеволл Э.О., Эйлерцен К-Э, Брокс Дж., Драгнес Б.Т., Фалькенберг П. и др.(2008) Диеты из морепродуктов: гиполипидемические и антиатерогенные эффекты таурина и n-3 жирных кислот. Атеросклероз 200: 396.
    14. 14. Oliveira AP, Patil KR, Nielsen J (2008) Архитектура схем регуляции транскрипции связана с топологией сетей биомолекулярных взаимодействий. BMC Syst Biol 2: 17.
    15. 15. Quek LE, Nielsen LK (2008) О реконструкции модели метаболической сети в масштабе генома Mus musculus. Геном Информ 21: 89–100.
    16. 16. Vastrik I, D’Eustachio P, Schmidt E, Gopinath G, Croft D, et al. (2007) Reactome: база знаний о биологических путях и процессах. Геном Биол 8: R39.
    17. 17. Юдкин Ю.С. (2003) Жировая ткань, действие инсулина и сосудистые заболевания: воспалительные сигналы. Int J Obes Relat Metab Disord 27: Suppl 3S25–28.
    18. 18. De Gregorio E, Spellman PT, Tzou P, Rubin GM, Lemaitre B (2002) Пути Toll и Imd являются основными регуляторами иммунного ответа у дрозофилы.EMBO J 21: 2568–2579.
    19. 19. Bjorkbacka H (2006) Множественная роль передачи сигналов Toll-подобных рецепторов при атеросклерозе. Curr Opin Lipidol 17: 527–533.
    20. 20. Lionetti L, Mollica MP, Lombardi A, Cavaliere G, Gifuni G и др. (2009) От хронического переедания к инсулинорезистентности: роль способности накапливать жир и воспаления. Нутр Метаб Кардиоваск Дис. 19: 146–152.
    21. 21. Chapkin RS, Kim W, Lupton JR, McMurray DN (2009) Диетическая докозагексаеновая и эйкозапентаеновая кислоты: новые медиаторы воспаления.Простагландины Leukot Essent Fatty Acids 81: 187–191.
    22. 22. Ле Лей С., Криф С., Фарнье С., Лефрер I, Ле Лиепвр X и др. (2001) Холестерин, сигнал, зависящий от размера клетки, который регулирует метаболизм глюкозы и экспрессию генов в адипоцитах. J Biol Chem 276: 16904–16910.
    23. 23. Zhang B, Horvath S (2005) Общая структура для анализа сети взвешенной коэкспрессии генов. Stat Appl Genet Mol Biol 4: Article17.
    24. 24. Eberle D, Hegarty B, Bossard P, Ferre P, Foufelle F (2004) Факторы транскрипции SREBP: главные регуляторы липидного гомеостаза.Biochimie 86: 839–848.
    25. 25. Дюпаскье С.М., Дибров Э., Книш А.Л., Чунг П.К., Ли К.Г. и др. (2007) Диетическое льняное семя подавляет атеросклероз у мышей с дефицитом рецептора ЛПНП частично за счет антипролиферативного и противовоспалительного действия. Am J Physiol Heart Circ Physiol 293: h3394–2402.
    26. 26. Goldberg RB, Sabharwal AK (2008) Рыбий жир в лечении дислипидемии. Curr Opin Endocrinol Diabetes Obes 15: 167–174.
    27. 27. VanderLaan PA, Reardon CA, Thisted RA, Getz GS (2009) VLDL наилучшим образом предсказывает атеросклероз корня аорты у мышей с дефицитом рецепторов LDL.J. Lipid Res. 50: 376–385.
    28. 28. Sohal PS, Baracos VE, Clandinin MT (1992) Диетические жирные кислоты омега-3 изменяют синтез простагландинов, транспорт глюкозы и обмен белка в скелетных мышцах здоровых и диабетических крыс. Biochem J 286 (Pt 2): 405–411.
    29. 29. Pepe S, McLennan PL (2002) Состав жирных кислот сердечной мембраны модулирует потребление кислорода миокардом и постишемическое восстановление сократительной функции. Тираж 105: 2303–2308.
    30. 30.Peoples GE, McLennan PL, Howe PR, Groeller H (2008) Рыбий жир снижает частоту сердечных сокращений и потребление кислорода во время упражнений. J Cardiovasc Pharmacol 52: 540–547.
    31. 31. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z и др. (2002) Коактиватор транскрипции PGC-1 alpha управляет образованием медленно сокращающихся мышечных волокон. Природа 418: 797–801.
    32. 32. Nagahuedi S, Popesku JT, Trudeau VL, Weber JM (2009) Имитация естественного допинга мигрирующих куликов у малоподвижных перепелов: влияние пищевых жирных кислот n-3 на мышечные мембраны и экспрессию PPAR.J Exp Biol 212: 1106–1114.
    33. 33. Barber MD, McMillan DC, Preston T, Ross JA, Fearon KC (2000) Метаболический ответ на кормление у худеющих пациентов с раком поджелудочной железы и его модуляция с помощью пищевой добавки, обогащенной рыбьим жиром. Clin Sci (Лондон) 98: 389–399.
    34. 34. Райан А.М., Рейнольдс Дж. В., Хили Л., Бирн М., Мур Дж. И др. (2009) Энтеральное питание, обогащенное эйкозапентаеновой кислотой (EPA), сохраняет безжировую массу тела после хирургического вмешательства при раке пищевода: результаты двойного слепого рандомизированного контролируемого исследования.Энн Сург 249: 355–363.
    35. 35. Brostrom MA, Brostrom CO (2003) Динамика кальция и эндоплазматическая ретикулярная функция в регуляции синтеза белка: последствия для роста клеток и адаптивности. Cell Calcium 34: 345–363.
    36. 36. Dulloo AG, Decrouy A, Chinet A (1994) Подавление Са (2 +) -зависимого производства тепла в скелетных мышцах мышей за счет высокого потребления рыбьего жира. Метаболизм 43: 931–934.
    37. 37. Деннис П.Б., Яешке А., Сайто М., Фаулер Б., Козма С.К. и др.(2001) TOR млекопитающих: гомеостатический датчик АТФ. Наука 294: 1102–1105.
    38. 38. Расмуссен BB, Richter EA (2009) Баланс между клеточными процессами синтеза и распада белка: упражнения как модель для понимания молекулярных механизмов, регулирующих мышечную массу. J Appl Physiol 106: 1365–1366.
    39. 39. Van Assche T, Fransen P, Guns PJ, Herman AG, Bult H (2007) Измененная обработка Ca2 + гладкомышечных клеток в аорте мышей с дефицитом аполипопротеина E до развития атеросклеротических поражений.Клеточный кальций 41: 295–302.
    40. 40. Sjogren K, Hellberg N, Bohlooly YM, Savendahl L, Johansson MS и др. (2001) Содержание жира в организме мышей можно предсказать in vivo с помощью модифицированного метода двухэнергетической рентгеновской абсорбциометрии. J Nutr 131: 2963–2966.
    41. 41. Бургхардт Дж., Бергстром Дж., Креттек А., Сьоберг С., Борен Дж. И др. (2007) Эндогенный метаболит эстрадиола 2-метоксиэстрадиол снижает образование атеросклеротических поражений у самок мышей с дефицитом аполипопротеина E.Эндокринология 148: 4128–4132.
    42. 42. Иризарри Р.А., Хоббс Б., Коллин Ф., Бизер-Барклай Ю.Д., Антонеллис К.Дж. и др. (2003) Исследование, нормализация и обобщение данных уровня зондов с массивом олигонуклеотидов высокой плотности. Биостатистика 4: 249–264.
    43. 43. Эшбернер М., Болл С.А., Блейк Дж. А., Ботштейн Д., Батлер Н. и др. (2000) Генная онтология: инструмент для объединения биологии. Консорциум генных онтологий. Нат Генет 25: 25–29.
    44. 44. Биндеа Дж., Млечник Б., Хакл Х., Чароентонг П., Тосолини М. и др.(2009) ClueGO: плагин Cytoscape для расшифровки функционально сгруппированных онтологий генов и сетей аннотаций путей. Биоинформатика 25: 1091–1093.
    45. 45. Шеннон П., Маркиэль А., Озьер О., Балига Н.С., Ван Дж. Т. и др. (2003) Cytoscape: программная среда для интегрированных моделей сетей биомолекулярного взаимодействия. Genome Res 13: 2498–2504.

    Проблемы молекулярного исследования питания 2: количественная оценка пищевого фенотипа | Гены и питание

  • 1.

    Adiels M, Taskinen MR, Packard C, Caslake MJ, Soro-Paavonen A, Westerbacka J, Vehkavaara S, Hakkinen A, Olofsson SO, Yki-Jarvinen H, Boren J (2006) Перепроизводство крупных частиц ЛПОНП вызвано увеличением печени жирность у человека. Диабетология 49: 755–765

    PubMed Статья CAS Google ученый

  • 2.

    Арай Й., Хиросе Н. (2004) Старение и метаболизм ЛПВП у пожилых людей старше 100 лет. J Atheroscler Thromb 11: 246–252

    PubMed CAS Google ученый

  • 3.

    Argmann CA, Chambon P, Auwerx J (2005) Феногеномика мышей: быстрый путь к «системному метаболизму». Cell Metab 2: 349–360

    PubMed Статья CAS Google ученый

  • 4.

    Argmann CA, Champy MF, Auwerx J (2006) Оценка энергетического гомеостаза, глава 29. Curr Protoc Mol Biol

  • 5.

    Armitage JA, Poston L, Taylor PD (2008) Истоки ожирения, связанные с развитием и метаболический синдром: роль материнского ожирения.Front Horm Res 36: 73–84

    PubMed Статья Google ученый

  • 6.

    Austenaa LM, Carlsen H, Ertesvag A, Alexander G, Blomhoff HK, Blomhoff R (2004) Статус витамина A значительно изменяет активность ядерного фактора-kappaB, оцененную с помощью визуализации in vivo. FASEB J 18: 1255–1257

    PubMed CAS Google ученый

  • 7.

    Белл Дж. Д., Тейлор-Робинсон С. Д. (2000) Оценка экспрессии генов in vivo: магнитно-резонансная томография и спектроскопия.Джин Тер 7: 1259–1264

    PubMed Статья CAS Google ученый

  • 8.

    Боллард М.Э., Стэнли Э.Г., Линдон Дж. К., Николсон Дж. К., Холмс Э. (2005) Метабономические подходы на основе ЯМР для оценки физиологического влияния на состав биожидкостей. ЯМР Биомед 18: 143–162

    PubMed Статья CAS Google ученый

  • 9.

    Bouwens M, Afman LA, Muller M (2007) Голодание вызывает изменения профилей экспрессии генов мононуклеарных клеток периферической крови, связанные с увеличением бета-окисления жирных кислот: функциональная роль рецептора альфа, активируемого пролифератором пероксисом, в периферической крови человека мононуклеарные клетки.Am J Clin Nutr 86: 1515–1523

    PubMed CAS Google ученый

  • 10.

    Bunger M, Hooiveld GJ, Kersten S, Muller M (2007) Исследование функций PPAR с помощью технологии микрочипов — парадигма нутригеномики 7. Biochim Biophys Acta 1771: 1046–1064

    PubMed Google ученый

  • 11.

    Caldwell J (2004) Фармакогенетика и индивидуальные вариации в диапазоне адекватности аминокислот: биологические аспекты.J Nutr 134: 1600S – 1604S

    PubMed CAS Google ученый

  • 12.

    Кальвано С., Сяо В., Ричардс Д., Фелчиано Р., Бейкер Х, Чо Р., Чен Р., Браунштейн Б., Кобб Дж. П., Чоеке С. К., Миллер-Грациано С., Молдавер Л., Миндринос М., Дэвис Р., Tompkins R, Lowry S, LSCRPaHRt Injury (2005) Сетевой анализ системного воспаления у людей. Nature 437: 1032–1037

    PubMed Статья CAS Google ученый

  • 13.

    Карлсен Х, Александр Г., Остенаа Л. М., Эбихара К., Бломхофф Р. (2004) Молекулярная визуализация фактора транскрипции NF-kappaB, основного регулятора стрессовой реакции. Mutat Res 551: 199–211

    PubMed CAS Google ученый

  • 14.

    Choi SW, Benzie IFF, Ma SW, Strain JJ, Hannigan BM (2008) Острая гипергликемия и окислительный стресс: прямая причина и следствие? Free Rad Biol Med 44: 1217–1231

    PubMed Статья CAS Google ученый

  • 15.

    Collier JJ, Scott DK (2004) Сладкие изменения: гомеостаз глюкозы можно изменить, манипулируя генами, контролирующими метаболизм глюкозы в печени. Мол эндокринол 18: 1051–1063

    PubMed Статья CAS Google ученый

  • 16.

    Contag CH, Contag PR, Mullins JI, Spilman SD, Stevenson DK, Benaron DA (1995) Фотонное обнаружение бактериальных патогенов у живых хозяев 17. Mol Microbiol 18: 593–603

    PubMed Статья CAS Google ученый

  • 17.

    Contag PR, Olomu IN, Stevenson DK, Contag CH (1998) Биолюминесцентные индикаторы у живых млекопитающих. Nat Med 4: 245–247

    PubMed Статья CAS Google ученый

  • 18.

    Criqui MH (1986) Эпидемиология атеросклероза: обновленный обзор. Am J Cardiol 57: 18C – 23C

    PubMed Статья CAS Google ученый

  • 19.

    de Wilde J, Mohren R, van den BS, Boekschoten M, Dijk KW, de GP, Muller M, Mariman E, Smit E (2008) Кратковременное кормление с высоким содержанием жира приводит к морфологической и метаболической адаптации в скелетных мышцах мышей C57BL / 6J.Physiol Genom 32: 360–369

  • 20.

    Debey S, Zander T, Brors B, Popov A, Eils R, Schultze JL (2006) Высоко стандартизованный, надежный и экономичный метод анализа транскриптома всего генома периферической крови применительно к крупномасштабным клиническим испытаниям. Геномика 87: 653–664

    PubMed Статья CAS Google ученый

  • 21.

    Eady JJ, Wortley GM, Wormstone YM, Hughes JC, Astley SB, Foxall RJ, Doleman JF, Elliott RM (2005) Вариация профилей экспрессии генов мононуклеарных клеток периферической крови от здоровых добровольцев.Physiol Genom 22: 402–411

    Статья CAS Google ученый

  • 22.

    Elliott R, Pico C, Dommels Y, Wybranska I, Hesketh J, Keijer J (2007) Нутригеномные подходы для анализа пользы и риска пищевых продуктов и пищевых компонентов: определение маркеров здоровья. Br J Nutr 98: 1095–1100

    PubMed Статья CAS Google ученый

  • 23.

    Файн О., Кристал Б., ван О. Б., Самнер Л. В., Сансон С. А., Тейлор С., Харди Н., Каддура-Даук Р. (2006) Установление стандартов отчетности для метаболомических и метабономических исследований: призыв к участию.OMICS 10: 158–163

  • 24.

    Gambhir SS, Barrio JR, Phelps ME, Iyer M, Namavari M, Satyamurthy N, Wu L, Green LA, Bauer E, MacLaren DC, Nguyen K, Berk AJ, Cherry SR , Herschman HR (1999) Визуализация экспрессии репортерного гена, направляемого аденовирусами, у живых животных с помощью позитронно-эмиссионной томографии. Proc Natl Acad Sci USA 96: 2333–2338

    PubMed Статья CAS Google ученый

  • 25.

    Graham TE, Helge JW, MacLean DA, Kiens B, Richter EA (2000) Прием кофеина не изменяет углеводный или жировой обмен в скелетных мышцах человека во время упражнений.J Physiol 529 (Pt 3): 837–847

    PubMed Статья CAS Google ученый

  • 26.

    Haverkate F, Thompson SG, Pyke SD, Gallimore JR, Pepys MB (1997) Производство C-реактивного белка и риск коронарных событий при стабильной и нестабильной стенокардии. Европейская группа по изучению согласованных действий по борьбе с тромбозами и инвалидностью стенокардии. Ланцет 349: 462–466

    PubMed Статья CAS Google ученый

  • 27.

    Heikkinen S, Argmann CA, Champy MF, Auwerx J (2007) Оценка гомеостаза глюкозы, глава 29: Unit. Curr Protoc Mol Biol

  • 28.

    Huber SA, Sakkinen P, Conze D, Hardin N, Tracy R (1999) Интерлейкин-6 обостряет ранний атеросклероз у мышей. Артериосклер Thromb Vasc Biol 19: 2364–2367

    PubMed CAS Google ученый

  • 29.

    Jurgens HS, Schurmann A, Kluge R, Ortmann S, Klaus S, Joost HG, Tschop MH (2006) Гиперфагия, более низкая температура тела и снижение активности бегового колеса предшествуют развитию патологического ожирения у мышей Новой Зеландии с ожирением. .Physiol Genom 25: 234–241

    Статья Google ученый

  • 30.

    Kannel WB (2005) Обзор гемостатических факторов, участвующих в атеросклеротическом сердечно-сосудистом заболевании. Липиды 40: 1215–1220

    PubMed Статья CAS Google ученый

  • 31.

    King IB, Lemaitre RN, Kestin M (2006) Влияние диеты с низким содержанием жиров на состав жирных кислот в эритроцитах, фосфолипиды плазмы и эфиры холестерина: исследование биомаркера общего потребления жиров.Am J Clin Nutr 83: 227–236

    PubMed CAS Google ученый

  • 32.

    Клаус С., Мюнцберг Х., Трулов С., Хельдмайер Г. (1998) Физиология трансгенных мышей с абляцией бурого жира: ожирение связано с пониженной температурой тела. Am J Physiol 274: R287 – R293

    PubMed CAS Google ученый

  • 33.

    Kleemann R, Gervois PP, Verschuren L, Staels B, Princen HM, Kooistra T (2003) Фибраты подавляют экспрессию гена C-реактивного белка, стимулированного IL-1, в гепатоцитах путем снижения ядерной p50-NFkappa B Образование комплекса –C / EBP-beta.Кровь 101: 545–551

    PubMed Статья CAS Google ученый

  • 34.

    Клееманн Р., Вершурен Л., ван Эрк М.Дж., Никольский Ю., Кнуббен Н.Х., Верхей Э.Р., Смилде А.К., Хендрикс Х.Ф., Заделаар С., Смит Г.Дж., Казначеев В., Никольская Т., Мельников А., Хурт-Камеджо Е. , van der GJ, van OB, Kooistra T (2007) Атеросклероз и воспаление печени, вызванные повышенным потреблением холестерина с пищей: комбинированный анализ транскриптомики и метаболомики.Genome Biol 8: R200

  • 35.

    Kussmann M, Fdr Raymond, Affolter M (2006) Открытие биомаркеров в области питания и здоровья на основе OMICS. J Biotechnol 124: 758–787

    PubMed Статья CAS Google ученый

  • 36.

    Lagouge M, Argmann C, Gerhart-Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P, Auwerx J ( 2006) Ресвератрол улучшает функцию митохондрий и защищает от метаболических нарушений, активируя SIRT1 и PGC-1alpha.Ячейка 127: 1109–1122

    PubMed Статья CAS Google ученый

  • 37.

    Lamers RJAN, van Nesselrooij JHJ, Kraus VB, Jordan JM, Renner JB, Dragomir AD, Luta G, van der Greef J, DeGroot J (2005) Идентификация профиля метаболитов в моче, связанного с остеоартритом. Остеоартрит Хрящ 13: 762–768

    Статья CAS Google ученый

  • 38.

    Lamers RJ, DeGroot J, Spies-Faber EJ, Jellema RH, Kraus VB, Verzijl N, TeKoppele JM, Spijksma GK, Vogels JTWE, van der Greef J, van Nesselrooij JHJ (2003). и метаболические отпечатки пальцев, связанные с питательными веществами, у морских свинок, страдающих остеоартритом.J Nutr 133: 1776–1780

    PubMed CAS Google ученый

  • 39.

    Лю П.К., Мандевиль Дж.Б., Дай Дж., Дженкинс Б.Г., Ким Ю.Р., Лю С.Х. (2007) Транскрипционная МРТ: новый взгляд на живой мозг. Neuroscientist

  • 40.

    Madan M, Bishayi B, Hoge M, Amar S (2008) Атеропротекторная роль интерлейкина-6 в связанном с диетой и / или патогеном атеросклерозе с использованием модели гетерозигот ApoE на мышах. Атеросклероз 197: 504–514

    PubMed Статья CAS Google ученый

  • 41.

    Масуд Т.Ф., Гамбхир С.С. (2003) Молекулярная визуализация живых объектов: видение фундаментальных биологических процессов в новом свете. Genes Dev 17: 545–580

    PubMed Статья CAS Google ученый

  • 42.

    McMillen IC, Robinson JS (2005) Истоки развития метаболического синдрома: прогнозирование, пластичность и программирование. Physiol Rev 85: 571–633

    PubMed Статья CAS Google ученый

  • 43.

    Noguchi Y, Zhang QW, Sugimoto T, Furuhata Y, Sakai R, Mori M, Takahashi M, Kimura T (2006) Сетевой анализ аминокислот плазмы и тканей и создание аминокислотного индекса для потенциального диагностического использования. Am J Clin Nutr 83: 513S – 519S

    PubMed CAS Google ученый

  • 44.

    Pagmantidis V, Meplan C, van Schothorst EM, Keijer J, Hesketh JE (2008) Добавление к здоровым добровольцам питательно релевантных количеств селена увеличивает экспрессию генов биосинтеза лимфоцитарного белка.Am J Clin Nutr 87: 181–189

    PubMed CAS Google ученый

  • 45.

    Pietilñinen KH, Sysi-Aho M, Rissanen A, Sepp + ñnen-Laakso T, Yki-J + ñrvinen H, Kaprio J, Oresic M (2007) Приобретенное ожирение связано с изменениями липидомного профиля сыворотки независимо от генетических эффектов — исследование монозиготных близнецов. PLoS ONE 2: e218

  • 46.

    Reed MC, Nijhout HF, Neuhouser ML, Baird JF, Shane B, James SJ, Boynton A, Ulrich CM (2006) Математическая модель дает представление о пищевых и генетических аспектах фолиевой кислоты. опосредованный одноуглеродным метаболизмом.J Nutr 136: 2653–2661

    Google ученый

  • 47.

    Rein D, Schijlen E, Kooistra T, Herbers K, Verschuren L, Hall R, Sonnewald U, Bovy A, Kleemann R (2006) Потребление трансгенных флавоноидов томатов снижает C-реактивный белок в C-реактивном белке человека. трансгенных мышей больше, чем у томатов дикого типа. J Nutr 136: 2331–2337

    PubMed CAS Google ученый

  • 48.

    Ридкер PM (2007) Воспалительные биомаркеры и риски инфаркта миокарда, инсульта, диабета и общей смертности: последствия для долголетия.Nutr Rev 65: S253 – S259

    PubMed Статья Google ученый

  • 49.

    Ридкер PM, Hennekens CH, Buring JE, Rifai N (2000) C-реактивный белок и другие маркеры воспаления в прогнозировании сердечно-сосудистых заболеваний у женщин. N Engl J Med 342: 836–843

    PubMed Статья CAS Google ученый

  • 50.

    Rocca-Serra P, Brazma A, Parkinson H, Sarkans U, Shojatalab M, Contrino S, Vilo J, Abeygunawardena N, Mukherjee G, Holloway E, Kapushky M, Kemmeren P, Lara GG, Oezcimen Sansone SA (2003) ArrayExpress: общедоступная база данных по экспрессии генов в EBI.C R Biol 326: 1075–1078

    PubMed Статья CAS Google ученый

  • 51.

    Saal LH, Troein C, Vallon-Christersson J, Gruvberger S, Borg A, Peterson C (2002) Программная среда BioArray (BASE): платформа для комплексного управления и анализа данных микрочипов. Genome Biol 3: 3

    Статья Google ученый

  • 52.

    Sanderson LM, de Groot PJ, Hooiveld GJ, Koppen A, Kalkhoven E, Muller M, Kersten S (2008) Эффект синтетических диетических триглицеридов: новая парадигма исследования нутригеномики.PLoS ONE 3: e1681

    PubMed Статья Google ученый

  • 53.

    Sansone SA, Fan T, Goodacre R, Griffin JL, Hardy NW, Kaddurah-Daouk R, Kristal BS, Lindon J, Mendes P, Morrison N, Nikolau B, Robertson D, Sumner LW, Taylor C, van der WM, van OB, Fiehn O (2007b) Инициатива стандартов метаболомики. Nat Biotechnol 25: 846–848

  • 54.

    Sansone SA, Fan T, Goodacre R, Griffin JL, Hardy NW, Kaddurah-Daouk R, Kristal BS, Lindon J, Mendes P, Morrison N, Nikolau B., Robertson D. , Самнер Л. В., Тейлор С., ван дер В. М., ван О. Б., Файн О. (2007a) Инициатива стандартов метаболомики.Nat Biotechnol 25: 846–848

  • 55.

    Sarria B, Dainty JR, Fox TE, Fairweather-Tait SJ (2005) Оценка абсорбции железа у людей с использованием компартментного моделирования. Eur J Clin Nutr 59: 142–144

    PubMed Статья CAS Google ученый

  • 56.

    Schieffer B, Selle T, Hilfiker A, Hilfiker-Kleiner D, Grote K, Tietge UJ, Trautwein C, Luchtefeld M, Schmittkamp C, Heeneman S, Daemen MJ, Drexler H (2004) Влияние интерлейкина 6 о развитии и морфологии бляшек при экспериментальном атеросклерозе.Тираж 110: 3493–3500

    PubMed Статья CAS Google ученый

  • 57.

    Smilde AK, Jansen JJ, Hoefsloot HC, Lamers RJ, van der GJ, Timmerman ME (2005) ANOVA-одновременный компонентный анализ (ASCA): новый инструмент для анализа разработанных данных метаболомики. Bioinformatics 21: 3043–3048

  • 58.

    Tinsley FC, Taicher GZ, Heiman ML (2004) Оценка количественного метода магнитного резонанса для анализа состава всего тела мыши.Obes Res 12: 150–160

    PubMed Статья Google ученый

  • 59.

    Turner SM, Roy S, Sul HS, Neese RA, Murphy EJ, Samandi W, Roohk DJ, Hellerstein MK (2007) Диссоциация между потоками жировой ткани и экспрессией липогенных генов у мышей ob / ob. Am J Physiol Endocrinol Metab 292: E1101 – E1109

    PubMed Статья CAS Google ученый

  • 60.

    Ульрих К.М., Ниджхаут Х.Ф., Рид М.К. (2006) Математическое моделирование: эпидемиология встречается с системной биологией.Эпидемиологические биомаркеры рака Пред. 15: 827–829

    PubMed Статья Google ученый

  • 61.

    van den Bosch HM, De Wit NJ, Hooiveld GJ, Vermeulen H, van d, V, Houten SM, Kuipers F, Muller M, van der MR (2008) Безхолестериновая диета с высоким содержанием жиров подавляет экспрессия генов переносчиков холестерина в тонком кишечнике мышей. Am J Physiol Gastrointest Liver Physiol

  • 62.

    van Erk MJ, Blom WAM, van Ommen B, Hendriks HFJ (2006) Завтраки с высоким содержанием белка и углеводов по-разному изменяют транскриптом клеток крови человека.Am J Clin Nutr 84: 1233–1241

    PubMed Google ученый

  • 63.

    ван Оммен Б., Стирум Р. (2002) Нутригеномика: использование системной биологии в области питания и здоровья. Curr Opin Biotechnol 13: 517–521

    PubMed Статья Google ученый

  • 64.

    Vickers MH, Krechowec SO, Breier BH (2007) Запрограммировано ли более позднее ожирение в утробе матери? Curr Drug Targets 8: 923–934

    PubMed Статья CAS Google ученый

  • 65.

    Weissleder R, Moore A, Mahmood U, Bhorade R, Benveniste H, Chiocca EA, Basilion JP (2000) Магнитно-резонансная томография экспрессии трансгена in vivo. Nat Med 6: 351–355

    PubMed Статья CAS Google ученый

  • 66.

    Weissleder R, Tung CH, Mahmood U, Bogdanov A Jr (1999) Визуализация опухолей in vivo с помощью активируемых протеазой флуоресцентных зондов ближнего инфракрасного диапазона. Nat Biotechnol 17: 375–378

    PubMed Статья CAS Google ученый

  • 67.

    Williams CM, Ordovas JM, Lairon D, Hesketh JE, Lietz G, Gibney MJ, Ommen B (2008) Проблемы исследования молекулярного питания 1 — связь генотипа со здоровым питанием. Гены Нутр 1-6-2008. Тип ссылки: Generic

  • 68.

    Wybranska I, Malczewska-Malec M, Niedbal S, Naskalski JW, Dembinska-Kiec A (2003) Полиморфизм NcoI гена TNF-альфа в положении -308 промотора влияет на резистентность к инсулину и повышает уровень триглицеридов в сыворотке крови после постпрандиальной липемии при привычном ожирении.Clin Chem Lab Med 41: 501–510

    PubMed Статья CAS Google ученый

  • 69.

    Ян М., Баранов Э., Цзян П., Сан FX, Ли ХМ, Ли Л., Хасегава С., Буве М., Аль-Тувайджри М., Чисима Т., Шимада Х., Мосса А.Р., Пенман С., Хоффман Р.М. ( 2000) Оптическая визуализация всего тела зеленых флуоресцентных опухолей и метастазов, экспрессирующих белок. Proc Natl Acad Sci USA 97: 1206–1211

    PubMed Статья CAS Google ученый

  • 70.

    Етукури Л., Экроос К., Видал-Пуиг А., Оресич М. (2008) Информатика и вычислительные стратегии для изучения липидов. Мол Биосист 4: 121–127

    PubMed Статья CAS Google ученый

  • 71.

    Етукури Л., Катаямаа М., Медина-Гомес Г., Сеппанен-Лааксо Т., Видал-Пуиг А., Оресик М. (2007) Биоинформатические стратегии для липидомного анализа: характеристика стеатоза печени, связанного с ожирением. BMC Syst Biol 1:12

    PubMed Статья Google ученый

  • 72.

    Zeisel SH, Freake HC, Bauman DE, Bier DM, Burrin DG, German JB, Klein S, Marquis GS, Milner JA, Pelto GH, Rasmussen KM (2005) Фенотип питания в эпоху метаболомики. J Nutr 135: 1613–1616

    PubMed CAS Google ученый

  • сравнение морфологического и молекулярного анализов рациона хищных пометов | Журнал маммологии

    Аннотация

    Для принятия разумных решений по сохранению и управлению требуется понимание рациона вида.Традиционно для оценки рациона использовался морфологический анализ непереваренных твердых частей пищевых продуктов, оставшихся в помете. Совсем недавно молекулярный анализ помета использовался для идентификации ДНК растений и видов добычи, но ни в одном исследовании не сравнивались морфологические и молекулярные анализы рациона крупных наземных хищников. Мы использовали молекулярные инструменты, чтобы определить процент помета черного медведя и койота, которые содержали 3 основных вида добычи (карибу, лось и зайцы-снегоступы) на Ньюфаундленде, и сравнили результаты с традиционным морфологическим анализом.Мы обнаружили, что ранжирование относительных частот добычи было согласованным между двумя методами, но молекулярные методы, как правило, выявляли виды жертв в большем проценте пометов для всех видов жертв. Однако были отдельные пометы, в которых жертва была обнаружена только морфологическими методами, и мы предоставляем доказательства того, что молекулярные методы могут привести к ложноотрицательным результатам, если ДНК жертвы не распределена равномерно в помете или в результате несогласованности ПЦР. Мы также обнаружили, что сравнение стоимости одного образца между морфологическим и молекулярным анализами зависело от того, нужен ли молекулярный тест для идентификации помета для хищников, стоимости разработки молекулярных методов и количества обрабатываемых образцов.Мы рекомендуем проводить исследования контролируемого кормления для проверки молекулярных методов и изучения применимости молекулярных методов для оценки пропорций потребляемых пищевых продуктов.

    черный медведь, Canis , latrans , карибу, койот, анализ рациона, ньюфаундленд, неинвазивный генетический отбор, Rangifer tarandus , собака для обнаружения копро, Ursus americanus

    Знание потребностей вида в ресурсах особенно важно для понимания потребности среды обитания (Litvaitis 2000).В частности, рацион вида может предоставить информацию о том, как он потребляет и / или конкурирует с другими членами своего сообщества (Klare et al. 2011). Исследование содержимого желудка и помета — наиболее распространенный метод оценки рациона наземных животных (Litvaitis 2000). Анализ разброса особенно привлекателен из-за простоты сбора и реализации, а также его неразрушающего и неинвазивного характера, особенно при изучении редких или неуловимых видов (Valentini et al.2009) или виды, требующие сохранения (Mills 1996).

    Традиционно, анализ твердой части или морфологического скопления влечет за собой идентификацию непереваренного животного или растительного материала (Casper et al. 2007a), такого как кости, зубы, волосы, перья, чешуя, экзоскелеты (Litvaitis 2000), отолиты (Casper et al. . 2007b), а также макро- или микроскопический растительный материал (Valentini et al. 2009). Обычно выполняется определение доли пометов, содержащих продукт питания (частота встречаемости); тем не менее, определение объема или массы пищевых частей из определенного пищевого продукта в пропорции ко всем пищевым продуктам в сочетании с поправочными коэффициентами для конкретных видов предпочтительнее, поскольку это обеспечивает лучшую оценку вклада пищевых продуктов в рацион вида. (Клар и др.2011). Независимо от подхода, точность морфологических методов может быть ограничена из-за отсутствия идентифицируемых твердых частей (Casper et al. 2007a), различных задержек в выделении твердых частей между продуктами питания (Casper et al. 2007a) и трудностями различения между твердыми частями близкородственных видов (Spaulding 2000; Zeale et al. 2011). В последнее время применяемые молекулярные методы могут ограничить или устранить некоторые из этих проблем, позволяя объективно идентифицировать пищевые продукты как по мягкому, так и по твердому веществу, присутствующему в пометах (Tollit et al.2009), но также имеют свои собственные ограничения, такие как невозможность амплифицировать ДНК из сильно деградированных пометов (Tollit et al. 2009) и дорогостоящее специализированное оборудование.

    Исследователи использовали молекулярные методы для изучения рациона различных видов животных. Помёт ластоногих (Deagle et al. 2005; Casper et al. 2007a, 2007b; Matejusová et al. 2008; Tollit et al. 2009; Bowles et al. 2011), пингвинов (Deagle et al. 2007, 2010), афалина дельфины ( Tursiops truncatus — Dunshea 2009), серны ( Rupicapra rupicapra — Rayé et al.2011), домашних овец (Pegard et al. 2009), снежных барсов ( Panthera uncia — Shehzad et al. 2012a), леопардовых кошек ( Prionailurus bengalensis — Shehzad et al. 2012b) и летучих мышей (Zeale et al. 2011) были проанализированы молекулярными методами. Valentini et al. (2009) продемонстрировали полезность подхода ДНК-штрих-кодирования, идентифицируя рацион преимущественно травоядных позвоночных и беспозвоночных с помощью фрагмента ДНК хлоропластного генома (петля P6 из trn L [UAA] интрона).Некоторые исследователи следовали аналогичному подходу, используя сайты рестрикции, которые встречаются у широкого круга видов (Dunshea 2009; Pegard et al. 2009; Deagle et al. 2010; Rayé et al. 2011; Shehzad et al. 2012a, 2012b). , но другие полагались на специфичные для вида или таксона маркеры для определения известных продуктов питания (Matejusová et al. 2008; Bowles et al. 2011; Zeale et al. 2011).

    Насколько нам известно, только 3 исследования сравнивали результаты морфологического и молекулярного анализов.Проведенное экспериментальное исследование кормления морских котиков в неволе ( Arctocephalus spp.) Показало, что молекулярные методы обнаруживают виды добычи раньше, чем после кормления, чаще и в течение более предсказуемого периода времени по сравнению с морфологическими методами (Casper et al. 2007a). Однако в исследовании диких звездных морских львов ( Eumetopias jubatus ) молекулярный анализ не смог идентифицировать вид жертвы в 22% помета, но смог идентифицировать жертву вида, когда морфологические методы были ограничены родом (Tollit et al.2009 г.). Толлит и др. (2009) также сообщили о значительных различиях в показателях обнаружения между двумя методами для определенных видов добычи. Молекулярные методы также обеспечили большее разрешение видов в исследовании насекомоядных летучих мышей и обнаружили несколько дополнительных порядков (Zeale et al. 2011). Однако, несмотря на важность понимания рациона крупных наземных плотоядных животных (Mills et al. 1992), ни в одном исследовании не сравнивались результаты морфологического и молекулярного анализа в наземной системе, содержащей крупные плотоядные виды.Интерпретация взаимоотношений хищник-жертва в такой системе и, следовательно, управленческие решения могут различаться в результате различий в скорости обнаружения различных видов жертв.

    Остров Ньюфаундленд, Канада, представляет собой отличную исследовательскую систему для сравнения морфологического и молекулярного анализов рациона из-за относительной простоты системы хищник-жертва. Черные медведи ( Ursus americanus ) в значительной степени зависят от растительности, но также потребляют большое количество мяса, особенно весной, когда много зимних лосей ( Alces alces ) и карибу ( Rangifer tarandus ), и особенно новорожденных. телята, присутствуют.Койоты ( Canis latrans ) только недавно иммигрировали на Ньюфаундленд (1980-е годы), но были подтверждены как один из основных хищников оленей карибу (Mahoney and Weir 2009; Lewis and Mahoney 2014; Mumma et al.2014), а также потребляют лосей, зайцы-снегоступы ( Lepus americanus ) и другие мелкие млекопитающие. Учитывая недавнее сокращение (> 66% с 1998 года) популяции карибу на Ньюфаундленде, частично вызванное увеличением хищничества телят (Mahoney and Weir 2009), оценка методов, используемых для оценки рациона двух основных хищников оленей карибу, является оправданной. .

    Нашей целью было оценить возможность использования молекулярных инструментов для обнаружения 3 потенциально распространенных предметов добычи в помете 2 крупных наземных хищников и определить, как эти результаты соотносятся с морфологическим анализом. Мы сосредоточились на ограниченном количестве объектов добычи, чтобы обеспечить прямое сравнение методов. Мы предположили, что молекулярные методы позволят идентифицировать вид жертвы в большем проценте помета, но что морфологические методы позволят идентифицировать вид жертвы в некоторых пометах, где молекулярные методы не помогли из-за сбоя ПЦР или отсутствия однородности ДНК жертвы на всем помете. .Мы оценили оба этих возможных объяснения сбоев молекулярных методов, а также сравнили затраты на эти 2 метода.

    Материалы и методы

    Учебный сайт.

    Ньюфаундленд (111,390 км, 2 ) — остров у восточного побережья Канады с прохладным морским климатом, характеризующимся вкраплениями хвойных лесов, открытыми ветрами пустошами и торфяниками (McManus and Wood 1991). Мы выбрали 3 исследовательских участка (рис.1) населен 4 стадами карибу Ньюфаундленда (Ла-Пуаль, Северный полуостров, Сент-Энтони и Средний хребет), а также лосями, зайцами-снегоступами и хищными черными медведями и койотами (Rayl et al., 2014).

    Рис. 1.

    Расположение трех наших исследовательских участков и связанных с ними мест отела на острове Ньюфаундленд, Канада.

    Рис. 1.

    Расположение трех наших исследовательских участков и связанных с ними мест отела на острове Ньюфаундленд, Канада.

    Отбор проб ската.

    С июня по август 2009 года пометы черных медведей и койотов были собраны вдоль дорог и в районах, прилегающих к дорогам через Ла-Пуаль (~ 1700 км 2 ) и Северный полуостров (~ 2000 км 2 ) с помощью обученного помета. собака-обнаружитель (MacKay et al. 2008). Точки отбора проб были разбросаны по Ла-Пуаль (17 точек поиска) и Северному полуострову (18 точек поиска), чтобы увеличить количество отобранных участков обитания и отдельных хищников.Поиски собак с функцией обнаружения помета различались по расстоянию (5–10 км) и времени поиска (2–6 ч) в зависимости от количества найденных пометов и погоды. Собаководы в латексных перчатках помещали помет в полиэтиленовые пакеты и по возможности замораживали в конце каждого полевого дня. Перед лабораторной обработкой пометы размораживали и в общей сложности ~ 0,5 мл фекального материала удаляли из нескольких мест на внешней стороне каждого помета (Stenglein et al. 2010) и помещали в 2-мл пробирки для сбора, содержащие буфер DETS для предотвращения ДНК. деградация (Frantzen et al.1998). Пластиковые пакеты и пробирки были помечены номером образца и датой сбора, которые связывали образцы с электронной записью их координат GPS.

    Определение вида хищников.

    Образцы были извлечены с использованием мини-набора для стула ДНК Qiagen QIAamp (Qiagen Inc., Валенсия, Калифорния) в лаборатории, предназначенной для образцов ДНК с низким количеством и качеством, и экстракция ДНК включала отрицательный контроль. Мы протестировали каждый образец вместе с отрицательными контролями, используя тест на анализ фрагментов контрольной области митохондриальной ДНК (мтДНК), чтобы идентифицировать каждый образец по видам (Murphy et al.2000; Дален и др. 2004; Онорато и др. 2006; Mumma et al. 2014; Де Барба и др. 2014b), поскольку существовала возможность ошибочно идентифицировать нецелевую канадскую рысь ( Lynx canadensis ) и рыжую лисицу ( Vulpes vulpes ) за койот. Поскольку идентификация каждого помета до вида основана на отторженных эпителиальных клетках желудочно-кишечного тракта хищника, мы предположили, что ДНК жертвы будет превосходить ДНК хищника; поэтому мы сочли положительный результат по черному медведю или койоту признаком хорошего качества образца и что ДНК жертвы, если она присутствует, будет иметь высокую вероятность амплификации.Мы определили размеры аллелей с использованием генетического анализатора Applied Biosystems 3130xl (Applied Biosystems Inc., Фостер-Сити, Калифорния) и соответствующего программного обеспечения GeneMapper 3.7 (Applied Biosystems 2004).

    Разработка идентификации видов молекулярных жертв.

    Для нашего теста на определение молекулярных видов добычи были отобраны три основных вида добычи: карибу, лось и заяц-снегоступ. Контрольные образцы каждого вида добычи были собраны на Ньюфаундленде (карибу = 4 волоса, лось = 3 ткани и заяц-снегоступ = 3 ткани).ДНК выделяли из образцов волос в лаборатории, посвященной низкокачественной ДНК, и из образцов тканей в отдельной лаборатории с использованием набора DNeasy Blood and Tissue Kit (Qiagen Inc., Валенсия, Калифорния). Каждая экстракция включала отрицательный контроль для мониторинга загрязнения реагентов ПЦР.

    Все последовательности, доступные для видов-мишеней в области цитохрома b ( Cytb ) мтДНК, были загружены из Genbank (www.ncbi.nlm.nih.gov/genbank/). Эти последовательности, 8 карибу (номера доступа AY726672–8), 4 лося (номера доступа AY0, AY245520, EF077657 и M98484) и 3 зайца-снегоступа (номера доступа AF010152, AY2 и LAU58932), были использованы для разработки праймеров, которые будут target ~ 200 пар оснований (п.о.) у карибу и лося и ~ 375 п.о. у зайца-снегоступа в регионе Cytb .Затем мы использовали эти праймеры для получения данных о последовательности от контрольных жертв из нашей области исследования (таблица 1). ПЦР для секвенирования карибу и лося содержала 0,06 мкМ праймеров NFCytb F и NFCytb R, 1,5 мМ MgCl 2 , 0,4 мМ dNTP, 1X буфер для ПЦР Amplitaq gold и 0,5U ДНК-полимеразы Amplitaq Gold (Applied Biosystems Inc., Foster City, California) в конечном реакционном объеме 10 мкл. Температурный профиль этой реакции представлял собой этап начальной денатурации 95 ° C в течение 10 минут, за которым следовали 35 циклов при 95 ° C в течение 30 секунд, 50 ° C в течение 30 секунд и 72 ° C в течение 1 минуты.ПЦР и термический профиль для секвенирования зайца-снегоступа были такими же, как указано выше, за исключением использования праймеров LepusA F и LepusSeq R. Перед секвенированием продукт ПЦР очищали с помощью ExoSAP-IT (Affymetrix, Санта-Клара, Калифорния) в соответствии с протоколом производителя. Секвенирование проводили в реакциях объемом 10 мкл с использованием BigDye Terminator v3.1 (Applied Biosystems Inc., Фостер-Сити, Калифорния). Продукты секвенирования очищали с использованием набора для очистки BigDye XTerminator Purification Kit, а затем запускали на генетическом анализаторе 3130xl (Applied Biosystems Inc., Фостер-Сити, Калифорния). Мы использовали программу Sequencher 4.7 (Gene Codes 2000) для редактирования и выравнивания последовательностей с последовательностями из Genbank. Программа MacClade 4.0 использовалась для определения количества уникальных гаплотипов (Мэддисон, Мэддисон, 2003).

    Таблица 1. Праймеры ДНК

    , использованные при разработке теста идентификации молекулярной жертвы.

    Название праймера . Краситель . Последовательность праймера от 5 ‘до 3’ . Размер фрагмента (пары оснований) .
    NFCytb F 6-FAM ACCCACCCATTAATAAAAATTGT
    Tarandus3 R GAATTAAGCAGATTCCTAG 105
    Alces3 R GAATAGTCCTGTAAGGATTTGTAAG 129
    LepusA F 6-FAM TTAACCACTCCCTAATTGAC
    LepusA R TTACGTCTCGGCAGATATG 173
    NFCytb2 R TCGTCCTACATGTATAATA 210
    LepusSeq R TAGGGTTGTCCCAATGTAG 370
    Название праймера . Краситель . Последовательность праймера от 5 ‘до 3’ . Размер фрагмента (пары оснований) .
    NFCytb F 6-FAM ACCCACCCATTAATAAAAATTGT
    Tarandus3 R GAATTAAGCAGATTCCTAG 105
    Alces3 R GAATAGTCCTGTAAGGATTTGTAAG 129
    LepusA F 6-FAM TTAACCACTCCCTAATTGAC
    LepusA R TTACGTCTCGGCAGATATG 173
    NFCytb2 R TCGTCCTACATGTATAATA 210
    LepusSeq R TAGGGTTGTCCCAATGTAG 370
    Таблица 1.

    праймеров ДНК, используемых при разработке теста идентификации молекулярной жертвы.

    Название праймера . Краситель . Последовательность праймера от 5 ‘до 3’ . Размер фрагмента (пары оснований) .
    NFCytb F 6-FAM ACCCACCCATTAATAAAAATTGT
    Tarandus3 R GAATTAAGCAGATTCCTAG 105
    Alces3 R GAATAGTCCTGTAAGGATTTGTAAG 129
    LepusA F 6-FAM TTAACCACTCCCTAATTGAC
    LepusA R TTACGTCTCGGCAGATATG 173
    NFCytb2 R TCGTCCTACATGTATAATA 210
    LepusSeq R TAGGGTTGTCCCAATGTAG 370
    Название праймера . Краситель . Последовательность праймера от 5 ‘до 3’ . Размер фрагмента (пары оснований) .
    NFCytb F 6-FAM ACCCACCCATTAATAAAAATTGT
    Tarandus3 R GAATTAAGCAGATTCCTAG 105
    Alces3 R GAATAGTCCTGTAAGGATTTGTAAG 129
    LepusA F 6-FAM TTAACCACTCCCTAATTGAC
    LepusA R TTACGTCTCGGCAGATATG 173
    NFCytb2 R TCGTCCTACATGTATAATA 210
    LepusSeq R TAGGGTTGTCCCAATGTAG 370

    ДНК, выделенная из образцов ската, может разрушаться, что часто препятствует ПЦР-амплификации более длинных фрагментов ДНК (Kohn et al.1995; Мерфи и др. 2000). Таким образом, целью было создание видоспецифичных праймеров для амплификации относительно коротких фрагментов ДНК. Праймер NFCytb F был разработан для отжига с ДНК карибу и лося. Видоспецифичный обратный праймер был разработан для каждого вида на основе данных выровненных последовательностей, приведенных выше, для получения полос разного размера в сочетании с праймером NFCytb F (Tarandus3 R и Alces3 R; Таблица 1). Праймер Tarandus3 R амплифицировал фрагмент длиной 105 пар оснований (п.о.), а праймер Alces3 R амплифицировал фрагмент длиной 129 п.н. (Таблица 1).Для зайца-снегоступа был разработан видоспецифичный обратный праймер, который продуцировал фрагмент длиной 179 п.н. в сочетании с праймером LepusA F (таблица 1).

    Все праймеры были объединены в одну реакцию ПЦР, чтобы минимизировать время и затраты на анализ образцов. Эта ПЦР содержала 0,57 мкМ праймера NFCytb F; 0,14 мкМ праймеров Caribou3 R, Moose3 R, LepusA F и LepusA R; 0,5X Q раствор; и 1X Multiplex Mastermix (Qiagen Inc., Валенсия, Калифорния) в конечном реакционном объеме 7 мкл.Температурный профиль для этой реакции представлял собой начальную стадию денатурации 95 ° C в течение 10 минут, за которой следовали 15 циклов 94 ° C в течение 30 секунд, приземление, начиная с 65 ° C и снижаясь на 0,7 ° C каждый цикл в течение 30 секунд, 72 ° C для 1 мин, затем 35 циклов при 94 ° C в течение 30 секунд, 55 ° C в течение 30 секунд и 72 ° C в течение 1 минуты. Праймеры NFCytb F и LepusA F метили красителем 6-FAM. Продукты ПЦР обрабатывали на генетическом анализаторе 3130xl, используя стандарт размера Genescan 500 LIZ (Applied Biosystems Inc., Фостер-Сити, Калифорния). Результаты визуализировали с помощью Genemapper 3.7 (Applied Biosystems 2004).

    Валидация теста на определение видов молекулярных жертв.

    Для проверки теста на определение вида добычи были собраны образцы известного видового происхождения карибу ( n = 20 волос), лося ( n = 17 фекальных гранул) и зайцев-снегоступов ( n = 19 фекальных гранул). . В валидацию были включены 3 образца ткани, использованные для секвенирования лося и зайца-снегоступа. ДНК выделяли из образцов волос с помощью набора Qiagen DNeasy Blood and Tissue Kit (Qiagen Inc., Валенсия, Калифорния). ДНК из образцов осадка экстрагировали с использованием набора QIAamp Stool Kit (Qiagen Inc., Валенсия, Калифорния) с 1 модификацией протокола. Учитывая большой размер гранул лося, для погружения гранул использовали до 3 мл буфера ASL, чтобы отмыть клетки с максимально возможной площади поверхности. Затем мы удалили 1,4 мл буфера ASL вокруг гранулы и перешли к следующему этапу протокола. Экстракции ДНК проводились в лаборатории, предназначенной для образцов ДНК низкого качества, и каждая экстракция содержала отрицательный контроль для проверки на загрязнение реагентами.Затем экстракты ДНК были протестированы с использованием теста идентификации видов молекулярных жертв, и результаты были сопоставлены с известными видами происхождения добычи.

    Идентификация видов молекулярных жертв.

    Мы использовали тест на определение видов молекулярной добычи для определения присутствия карибу, лося и зайца-снегоступа во всех пометах, которые дали положительный результат, как черный медведь или койот, собранных на участках исследования Ла-Пуаль и Северного полуострова в 2009 г. Все прогоны ПЦР включали: отрицательный контроль для контроля загрязнения.Все образцы были протестированы в двух экземплярах, а образцы с неясными результатами были повторно протестированы до 2 дополнительных раз, чтобы уточнить наличие или отсутствие видов добычи. Для положительной идентификации вида жертвы требовался четкий пик, превышающий 200 флуоресцентных единиц, который напоминал форму положительных контролей и отличался от неспецифического шума, по крайней мере, в одной из повторяющихся ПЦР для каждого образца. Образцы подвергались повторному тестированию, если после анализа повторных ПЦР оставалась неопределенность.Мы сравнили окончательный результат с первыми двумя ПЦР, чтобы определить согласованность результатов ПЦР. Как молекулярный, так и морфологический анализ проводились вслепую в отношении результатов другого метода идентификации жертвы, чтобы избежать возможной систематической ошибки.

    Определение морфологического вида жертвы.

    Все пометы, проанализированные с помощью нашего теста на определение видов молекулярных жертв, также были проанализированы с использованием стандартных морфологических анализов непереваренных твердых частей пищевых продуктов, оставшихся в пометах (Reynolds and Aebischer 1991).Размороженные пометы очищали по отдельности промыванием на сите с размером ячеек 2,0 мм, а затем сушили до постоянной массы в сушильном шкафу при 40–50 ° C в течение 24–48 часов. Мы поместили высушенное содержимое ската на лоток размером 30 × 20 см с сеткой 2 × 5 линий (10 пересечений) внизу и равномерно распределили содержимое помета по сетке. Мы выбрали часть пищевого продукта, пересекающуюся или ближайшую к каждому пересечению сетки, чтобы получить репрезентативную выборку содержания разброса. Мы закрепили образцы волос на пластиковом покровном стекле между 2 предметными стеклами, закрепленными 4 зажимами для бумаги.Волосы помещали в обычную тостерную печь при высокой мощности на 10 минут, чтобы расплавить кутикулярный мозаичный узор на пластиковом покровном стекле, а затем удаляли с пластикового покровного стекла. И волосы, и покровное стекло были приклеены к таблице данных и исследованы под увеличением. Мы изучили структуру кутикулы, мозгового вещества и поперечных срезов под микроскопом и сравнили их с эталонной коллекцией волосков, представляющих различные области тела, у всех местных потенциальных жертв.Чтобы помочь идентифицировать другие пищевые продукты, мы собрали эталонные образцы муравьев, а также потенциальные растительные пищевые продукты (включая листья, ягоды и семена) на разных фонологических стадиях из наших исследовательских участков. Мы также идентифицировали эти и другие останки (например, перья), используя соответствующие таксономические ключи и руководства. Для сравнения морфологических и молекулярных методов мы просто подсчитали, встречался ли данный вид целевой жертвы (карибу, лось или заяц на снегоступах) в данном помете.

    Сравнение морфологического и молекулярного методов.

    Мы оценили, соответствует ли ранжирование относительной частоты добычи разными методами, и использовали двухсторонний критерий хи-квадрат МакНемара с поправками на непрерывность (Agresti 1990) в R (R Development Core Team 2014), чтобы оценить, были ли различия для каждой жертвы. виды (карибу, лось или заяц-снегоступ) между парными морфологическими и молекулярными результатами. Чтобы оценить вероятность ложноположительных и отрицательных результатов, мы составили таблицу количества пометов, которые согласились и не согласились между методами для каждого вида добычи.

    Мы также сравнили стоимость / выборку, связанную с каждым методом, которая включает затраты на поставку и затраты на техников, исходя из ставки заработной платы 15 долларов США в час. Поскольку состав сообщества хищников определяет, нужен ли молекулярный тест на определение вида хищника для различения морфологически схожих пометов хищников, мы не представляем стоимость теста на определение вида хищников, потому что он будет одинаковым для обоих анализов рациона. Тем не менее, мы сообщаем о затратах на анализ молекулярной диеты с затратами на экстракцию и без нее, поскольку экстракция будет дополнительными затратами на молекулярный анализ в системах, которые не требуют молекулярного теста для определения вида хищников.Наши оценки для молекулярного анализа основаны на обработке образцов партиями ~ 20 во время экстракции и ~ 96 во время ПЦР. Мы также предоставляем стоимость / образец вместе с затратами на разработку теста на определение видов молекулярных жертв и без них. Поскольку затраты на разработку одного образца уменьшаются по мере увеличения количества образцов, мы представляем стоимость / образец для 100, 500 и 1000 образцов. Все оценки затрат предполагают, что разница в стоимости полевых сборов незначительна, и предполагают доступ к государственному или университетскому учреждению, содержащему специализированное оборудование для молекулярного анализа.

    Проверка однородности ската.

    В 2012 г. собаки для обнаружения помета были доставлены на вертолете в отдаленные районы Среднего хребта для обнаружения помета черного медведя и койота в рамках более крупного исследования численности хищников. Были отобраны пять пометов черного медведя и 5 пометов койотов, чтобы оценить, равномерно ли распределена ДНК жертвы по всему помету. Мы взяли образцы каждого ската из 2 внешних и 2 внутренних местоположений, а затем протестировали 4 образца каждого ската в двух экземплярах.Мы оценили различия в обнаружении видов добычи по 4 образцам каждого отдельного помета.

    Результат

    Секвенирование ДНК и проверка определения видов молекулярных жертв.

    Фрагмент 210 п.н. области мтДНК Cytb был успешно амплифицирован и секвенирован для эталонных образцов 4 карибу и 3 лосей. Мы нашли в общей сложности 2 уникальных гаплотипа как для карибу, так и для лося. 8 последовательностей карибу (номера доступа AY726672–8) и 4 последовательности лосей (номера доступа AY0, AY245520, EF077657 и M98484) представляют 4 различных гаплотипа для каждого вида.Таким образом, мы использовали в общей сложности 6 гаплотипов от каждого вида для создания консервативного прямого праймера и видоспецифичных обратных праймеров. Мы амплифицировали и секвенировали фрагмент 370 п.н. области мтДНК Cytb для 3 эталонных образцов зайца-снегоступа и обнаружили 2 уникальных гаплотипа. Три последовательности зайца-снегоступа (инвентарные номера AF010152, AY2 и U58932.1) представляют 2 гаплотипа, 1 из которых соответствует гаплотипу из контрольных образцов. Таким образом, 3 уникальных гаплотипа зайца-снегоступа были использованы для создания видоспецифичной пары праймеров.

    Все проверочные образцы, которые дали продукт ПЦР (карибу n = 20, лось n = 16 и заяц-снегоступ n = 20), показали полосы правильного размера для каждого вида (Таблица 2). Кроме того, в проверочных образцах не было межвидовой амплификации. Все образцы, которые не смогли произвести продукт ПЦР, были фекальными осадками, что, вероятно, связано с деградацией ДНК в этих образцах, а не с ошибкой теста на определение вида жертвы.

    Таблица 2.

    Известные образцы, использованные при разработке теста на определение молекулярной жертвы.

    Виды . Тип образца . Количество образцов . Число успехов .
    Карибу Собранные волосы 20 20
    Лось Ткань 3 3
    972 922 972 922 922 922 922 9227
    972 922 Фекальный пеллет Ткань 3 3
    Фекальный осадок 19 19
    Виды . Тип образца . Количество образцов . Число успехов .
    Карибу Собранные волосы 20 20
    Лось Ткань 3 3
    972 922 972 922 922 922 922 9227
    972 922 Фекальный пеллет Ткань 3 3
    Фекальный осадок 19 19
    Таблица 2.

    Известные образцы, использованные при разработке теста на определение молекулярной жертвы.

    Виды . Тип образца . Количество образцов . Число успехов .
    Карибу Собранные волосы 20 20
    Лось Ткань 3 3
    972 922 972 922 922 922 922 9227
    972 922 Фекальный пеллет Ткань 3 3
    Фекальный осадок 19 19
    Виды . Тип образца . Количество образцов . Число успехов .
    Карибу Собранные волосы 20 20
    Лось Ткань 3 3
    972 922 972 922 922 922 922 9227
    972 922 Фекальный пеллет Ткань 3 3
    Фекальный осадок 19 19
    Сравнение морфологических и молекулярных результатов.

    Мы проверили 140 пометов черных медведей и 156 пометов койотов на предмет остатков добычи. Все отрицательные контроли экстракции и контроли ПЦР были отрицательными. Оба метода определили, что лоси являются наиболее распространенной добычей черных медведей, за ними следуют карибу и заяц-снегоступы, хотя различия в процентном соотношении помета, содержащего лосей и карибу, не были значительными в рамках методов (рис. 2A). Лось также был наиболее распространенным объектом для койотов, за ним следовали зайцы на снегоступах и карибу, но ни один из процентных соотношений, оцененных с помощью морфологических методов, не отличался значительно, а лось и заяц-снегоступ не имели значительных различий для молекулярного анализа (рис.2Б).

    Рис. 2.

    Процентное содержание (и 95% CI ) пометов А) черного медведя и Б) койотов, содержащих карибу, лося и зайца-снегоступа, как определено морфологическим и молекулярным анализами.

    Рис. 2.

    Процент (и 95% CI ) А) помета черного медведя и Б) помета койота, содержащего карибу, лося и зайца-снегоступа, как определено морфологическим и молекулярным анализами.

    Тем не менее, мы обнаружили различия в процентном соотношении пометов, содержащих виды добычи, между морфологическими и молекулярными методами для пометов койотов и черных медведей (рис.2А и Б). В целом, морфологический анализ выявил один или несколько видов добычи в 34% пометов черных медведей и 78% пометов койотов, в то время как молекулярный анализ выявил один или несколько видов жертв в 70% и 90% пометов черных медведей и койотов, соответственно. Мы обнаружили существенные различия между методами определения процентного содержания помета черного медведя, содержащего карибу ( χ 2 = 14,58 df = 1 , P = <0,001), лосей ( χ 2 = 20.94 д.ф. = 1 , P = <0,001) и зайца-снегоступа ( χ 2 = 4,9 d.f. = 1 , P = <0,027). У койотов молекулярные методы обнаружили значительно более высокий процент помета, содержащего лосей ( χ 2 = 27,12 df = 1 , P = < 0,001) и зайцев-снегоступов ( χ 2 ). = 11.5 д.ф. = 1 , P = < 0,001), но не карибу ( χ 2 = 1,62 d.f. = 1 , P > 0,203) по сравнению с морфологическими методами.

    Хотя большинство пометов согласуются между методами в отношении наличия определенного вида добычи, значительное количество пометов различается между методами. Морфологический и молекулярный анализы совпали для 64%, 63% и 92% пометов черных медведей относительно наличия или отсутствия карибу, лося и зайца-снегоступа, соответственно (Таблица 3).Морфологический и молекулярный анализы помета койотов согласились для 68%, 62% и 70% для карибу, лося и зайца-снегоступа, соответственно (Таблица 3). Положительные молекулярные и отрицательные морфологические результаты были более частыми разногласиями (6–31%) для пометов от любого хищника, но были также разногласия (<1–13%) для отрицательных молекулярных и положительных морфологических анализов (Таблица 3).

    Таблица 3.

    Процент пометов, которые согласны или не согласны между молекулярными и морфологическими методами в отношении присутствия (+) или отсутствия (-) карибу, лося или зайца-снегоступа (e.г. карибу был обнаружен обоими методами (+ / +) в 8% пометов черных медведей). Согласованные методы равняются объединенному проценту пометов, у которых оба метода обнаружили (+ / +) или не обнаружили (- / -) вид жертвы.

    %) % 6%) () 7%)
    Хищник . Метод анализа . ——————-> . Морфологический . Методы согласны .
    Черный медведь ( n = 140) Молекулярный Карибу (+) (-) (64%)
    (+) (28%)
    (-) (8%) (56%)
    Черный медведь ( n = 140) Молекулярный Лось (+) (-) (63%)
    (+) (42%) (31%)
    (-) (6%) (21%)
    Черный медведь ( n = 140) Молекулярный Заяц-снегоступ (+) (-) (92%)
    (+) (1%)
    (-) (> 1%) (91%)
    Койот ( n 9000 4 = 156) Молекулярный Карибу (+) (-) (68%)
    (+) (22%) (19%)
    ) -) (13%) (46%)
    Койот ( n = 156) Молекулярный Лось (+) (-) (
    (+) (37%) (32%)
    (-) (6%) (25%)
    Койот ( n = 156) Молекулярный Заяц-снегоступ (+) (-) (70%)
    (+) (35%) (22%)
    (-) (35%)
    %) % 6%) ( 9%) -) ) 7%)
    Хищник . Метод анализа . ——————-> . Морфологический . Методы согласны .
    Черный медведь ( n = 140) Молекулярный Карибу (+) (-) (64%)
    (+) (28%)
    (-) (8%) (56%)
    Черный медведь ( n = 140) Молекулярный Лось (+) (-) (63%)
    (+) (42%) (31%)
    (-) (6%) (21%)
    Черный медведь ( n = 140) Молекулярный Заяц-снегоступ (+) (-) (92%)
    (+) (1%)
    (-) (> 1%) (91%)
    Койот ( n 9000 4 = 156) Молекулярный Карибу (+) (-) (68%)
    (+) (22%) (19%)
    (
    (13%) (46%)
    Койот ( n = 156) Молекулярный Лось (+) (-) (
    (+) (37%) (32%)
    (-) (6%) (25%)
    Койот ( n = 156) Молекулярный Заяц-снегоступ (+) (-) (70%)
    (+) (35%) (22%)
    (-) (35%)
    Таблица 3.

    Процент пометов, которые согласуются или не согласуются между молекулярными и морфологическими методами в отношении наличия (+) или отсутствия (-) карибу, лося или зайца-снегоступа (например, карибу был обнаружен обоими методами (+ / +) у 8 человек. % помета черного медведя). Согласованные методы равняются объединенному проценту пометов, у которых оба метода обнаружили (+ / +) или не обнаружили (- / -) вид жертвы.

    %) % 6%) () 7%)
    Хищник . Метод анализа . ——————-> . Морфологический . Методы согласны .
    Черный медведь ( n = 140) Молекулярный Карибу (+) (-) (64%)
    (+) (28%)
    (-) (8%) (56%)
    Черный медведь ( n = 140) Молекулярный Лось (+) (-) (63%)
    (+) (42%) (31%)
    (-) (6%) (21%)
    Черный медведь ( n = 140) Молекулярный Заяц-снегоступ (+) (-) (92%)
    (+) (1%)
    (-) (> 1%) (91%)
    Койот ( n 9000 4 = 156) Молекулярный Карибу (+) (-) (68%)
    (+) (22%) (19%)
    ) -) (13%) (46%)
    Койот ( n = 156) Молекулярный Лось (+) (-) (
    (+) (37%) (32%)
    (-) (6%) (25%)
    Койот ( n = 156) Молекулярный Заяц-снегоступ (+) (-) (70%)
    (+) (35%) (22%)
    (-) (35%)
    %) % 6%) ( 9%) -) )
    Хищник . Метод анализа . ——————-> . Морфологический . Методы согласны .
    Черный медведь ( n = 140) Молекулярный Карибу (+) (-) (64%)
    (+) (28%)
    (-) (8%) (56%)
    Черный медведь ( n = 140) Молекулярный Лось (+) (-) (63%)
    (+) (42%) (31%)
    (-) (6%) (21%)
    Черный медведь ( n = 140) Молекулярный Заяц-снегоступ (+) (-) (92%)
    (+) (1%)
    (-) (> 1%) (91%)
    Койот ( n 9000 4 = 156) Молекулярный Карибу (+) (-) (68%)
    (+) (22%) (19%)
    (
    (13%) (46%)
    Койот ( n = 156) Молекулярный Лось (+) (-) (
    (+) (37%) (32%)
    (-) (6%) (25%)
    Койот ( n = 156) Молекулярный Снежный заяц (+) (-) (70%)
    (+) (35%) (22%)
    (-) 7%) (35%)
    Последовательность ПЦР и однородность ската.

    Мы обнаружили, что 16% (карибу), 11% (лось) и 3% (заяц на снегоступах) повторных ПЦР-тестов помета черного медведя не дали одинаковых результатов по видам добычи. Повторные ПЦР-тесты помета койотов для карибу, лося и зайца-снегоступа не дали такого же результата в 8%, 11% и 6% соответственно. Мы также обнаружили, что 0/5, 1/5 и 0/5 помета черного медведя и 0/5, 1/5 и 1/5 помета койота не привели к тому же результату в отношении вида добычи (карибу, лось или заяц-снегоступы, соответственно) в 4 подвыборках, взятых из разных мест одного и того же помета.

    Сравнение затрат.

    Мы оценили стоимость морфологического анализа в $ 16,10 за образец (Таблица 4). Стоимость молекулярного анализа на образец без учета затрат на разработку, выделение ДНК и определение видов хищников составила 2,48 доллара США (Таблица 4). Когда мы включаем стоимость развития видов молекулярных жертв (~ 2000 долларов), частота анализа 100, 500 и 1000 образцов ската составила 22,48, 6,48 и 4,48 доллара соответственно (таблица 4). Если предположить, что молекулярный тест не требовался для определения вида хищников, стоимость молекулярного анализа рациона возрастает до 17 долларов.65 / образец, а после включения затрат на разработку стоимость образца увеличивается до 37,65 долларов США за 100 образцов, 21,65 долларов США за 500 образцов и 19,65 долларов США за 1000 образцов (Таблица 4).

    Таблица 4.

    Стоимость (в долларах США) морфологического анализа диеты и молекулярного анализа диеты пометов с разбивкой по стоимости разработки, стоимости поставки, времени технического специалиста, стоимости технического специалиста на образец и стоимости / образца для 100, 500 и 1000 образцов.

    2 долл.
    Метод анализа . Детализированные затраты . Итого .
    Стоимость разработки . Стоимость поставки . Техническое время (мин) . Стоимость технологий (15 долларов США в час) . Стоимость / образец (100) . Стоимость / образец (500) . Стоимость / образец (1000) .
    Морфологический идентификатор жертвы a 0 $ 1.10 60 15,00 $ 16,10 долл. США 16,10 долл. США 16,10 долл. США
    Идентификатор молекулярной жертвы a, b Не включено $ 1,60
    Молекулярная жертва ID a 2 000 долл. США 1,60 долл. США 3,5 долл. США 0,88 22,48 долл. США 6,48 долл. США долл. США 4.48
    Молекулярная экстракция и ID жертвы b, c Не включено 6,40 долл. США 45 11,25 долл. США 17,65 долл. США 17,65 долл. США долл. США 2 000 долл. США 6,40 долл. США 45 11,25 долл. США 37,65 долл. США 21,65 долл. США 19,65 долл. США
    2 долл.
    Метод анализа . Детализированные затраты . Итого .
    Стоимость разработки . Стоимость поставки . Техническое время (мин) . Стоимость технологий (15 долларов США в час) . Стоимость / образец (100) . Стоимость / образец (500) . Стоимость / образец (1000) .
    Морфологический идентификатор жертвы a 0 $ 1.10 60 15,00 $ 16,10 долл. США 16,10 долл. США 16,10 долл. США
    Идентификатор молекулярной жертвы a, b Не включено $ 1,60
    Молекулярная жертва ID a 2 000 долл. США 1,60 долл. США 3,5 долл. США 0,88 22,48 долл. США 6,48 долл. США долл. США 4.48
    Молекулярная экстракция и ID жертвы b, c Не включено 6,40 долл. США 45 11,25 долл. США 17,65 долл. США 17,65 долл. США долл. США 2 000 долл. США 6,40 долл. США 45 11,25 долл. США 37,65 долл. США 21,65 долл. США 19,65 долл. США стоимость поставки, время технического специалиста (Tech), стоимость технического специалиста за образец и стоимость за образец для 100, 500 и 1000 образцов.

    Метод анализа . Детализированные затраты . Итого .
    Стоимость разработки . Стоимость поставки . Техническое время (мин) . Стоимость технологий (15 долларов США в час) . Стоимость / образец (100) . Стоимость / образец (500) . Стоимость / образец (1000) .
    Морфологический идентификатор жертвы a 0 $ 1,10 60 $ 15,00 $ 16,10 $ 16,10 $ 16,10 $ 1,60 3,5 $ 0,88 $ 2,48 $ 2,48 $ 2,48
    ID молекулярной жертвы a $ 2,000 $ 1.60 3,5 0,88 долл. США 22,48 долл. США 6,48 долл. США долл. США $ 17,65
    Молекулярная экстракция и идентификатор добычи c $ 2,000 $ 6,40 45 $ 11,25 $ 37.65 21,65 19,65
    Метод анализа . Детализированные затраты . Итого .
    Стоимость разработки . Стоимость поставки . Техническое время (мин) . Стоимость технологий (15 долларов США в час) . Стоимость / образец (100) . Стоимость / образец (500) . Стоимость / образец (1000) .
    Морфологический идентификатор жертвы a 0 $ 1,10 60 $ 15,00 $ 16,10 $ 16,10 $ 16,10 $ 1,60 3,5 $ 0,88 $ 2,48 $ 2,48 $ 2,48
    ID молекулярной жертвы a $ 2,000 $ 1.60 3,5 0,88 долл. США 22,48 долл. США 6,48 долл. США долл. США $ 17,65
    Молекулярная экстракция и идентификатор добычи c $ 2,000 $ 6,40 45 $ 11,25 $ 37.65 21,65 19,65 долл.

    Обсуждение

    Хотя морфологические и молекулярные методы показали идентичные тенденции в ранжировании видов добычи в рационе черных медведей и койотов, было обнаружено большое количество расхождений между видами добычи, обнаруженными для отдельных пометов. Примерно одна треть сравнений различалась между морфологическими и молекулярными результатами по всем видам добычи (таблица 3), и тесты МакНемара (Agresti, 1990) показали, что результаты попарного помета были разными для всех видов жертв, кроме карибу в помете койотов.

    Наиболее частым разногласием между методами были положительные молекулярные и отрицательные морфологические результаты, которые могут указывать на то, что молекулярные методы имеют более высокие показатели обнаружения, хотя мы также наблюдали скаты с отрицательными молекулярными и положительными морфологическими результатами (Таблица 3). Молекулярные методы обнаружили значительно более высокую долю помета черного медведя и койота, содержащего добычу для 2 из 3 видов добычи. Каспер и др. (2007a) обнаружили более высокие показатели обнаружения жертв с помощью молекулярных методов, но в другом исследовании сообщалось о более низких показателях обнаружения с помощью молекулярных методов по сравнению с морфологическими методами (Tollit et al.2009 г.). Толлит и др. (2009) приписали снижение обнаружения старым пометам с деградированной ДНК, что, вероятно, было менее распространено в нашем исследовании, поскольку мы тестировали только пометы, которые были успешно идентифицированы как черный медведь или койот с помощью молекулярных анализов.

    Несколько факторов могут способствовать ложным срабатываниям и отрицательным результатам для обоих методов. И ложноположительные, и отрицательные результаты морфологического анализа помета могут быть результатом отнесения твердых частей к неправильным видам из-за технической ошибки (Spaulding et al.2000). Это особенно проблематично в системах с близкородственными видами и часто приводит к тому, что исследователи группируют виды по родам или более высоким таксономическим уровням (Zabala et al. 2003; Tollit et al. 2009; Zeale et al. 2011). В этом исследовании 1 человек усердно работал, чтобы правильно классифицировать 10 морфологических образцов от каждого помета; тем не менее, ошибки были возможны. Кроме того, ложноотрицательные результаты могут быть вызваны отсутствием в пометах волос, костей или других твердых частей. Это может быть менее вероятно для мелких млекопитающих, когда потребляется вся туша (Hewitt and Robbins 1996), но более вероятно, когда потребляются части крупных млекопитающих, такие как внутренности, которые содержат мало или совсем не содержат волос или костей.Ложноположительные результаты молекулярных анализов также могут быть результатом перекрестного загрязнения или появления неспецифических пиков на электрофореграммах. Мы ограничили вероятность ложноположительных результатов в результате перекрестного заражения, используя отрицательные контроли во время экстракции ДНК и ПЦР. Мы также были консервативны в назначении видов добычи путем повторного тестирования нечетких образцов и требующих сильных (> 200 единиц флуоресценции) и четких пиков (включали только пики, которые имели аналогичную форму, демонстрируемую положительными контролями и отличающиеся от неспецифического шума).Ложноотрицательные результаты могут быть результатом неравномерного распределения ДНК жертвы в скате или несогласованности ПЦР, что мы продемонстрировали, сравнив повторяющиеся результаты и протестировав разные места помета черного медведя и койота. Мы попытались ограничить эти источники ошибок в нашем исследовании, отбирая образцы фекалий из разных мест на каждом скате и тестируя образцы в двух экземплярах.

    В нашем исследовании сравнение затрат на образец между морфологическим и молекулярным анализами зависело от того, нужен ли молекулярный метод для идентификации помета для хищников, стоимости разработки молекулярных методов и количества обрабатываемых образцов.Стоимость морфологического анализа рациона превышала стоимость молекулярного анализа, если бы мы предположили, что необходим тест на определение молекулярного хищника и исключили затраты на разработку (Таблица 4). С учетом затрат на разработку морфологические методы превышали стоимость молекулярных методов, если было обработано ≥ 147 образцов. Однако, если помет не нужно было идентифицировать для хищников с помощью молекулярных методов, дополнительные затраты на экстракцию повышали стоимость молекулярного анализа рациона по сравнению со стоимостью морфологических методов, и разница еще больше увеличивалась за счет включения затрат на разработку для молекулярного теста.Следует также отметить, что оборудование, необходимое для проведения молекулярного анализа рациона, значительно дороже, чем оборудование, необходимое для морфологического анализа.

    Помимо низкой стоимости оборудования, морфологический анализ рациона имеет ряд других преимуществ. Непосредственный характер анализа твердых частей делает его легко доступным для широкого круга исследователей (Casper et al., 2007b), а морфологический анализ также позволяет анализировать сильно деградированные пометы, у которых вряд ли будет жизнеспособная ДНК (Tollit et al.2009 г.). Возможно, наиболее важным является возможность морфологического анализа как средства количественной оценки соотношения твердых частей к конкретным видам добычи (Klare et al. 2011). Количественная оценка потребляемой добычи позволяет оценить относительный вклад различных пищевых продуктов в рацион вида, а также возможность определить общую потребляемую биомассу, оценить выбор добычи, когда известно о ее наличии, и рассмотреть влияние на уровне популяции на виды добычи. Еще одним преимуществом морфологического анализа может быть возможность определять возраст потребляемых людей по разнице в размере твердых частей (Latham et al.2013 ). Хотя наша цель состояла в том, чтобы сравнить присутствие 3 основных видов добычи в рационах черного медведя и койота, следует упомянуть, что морфологический метод выявил дополнительные пищевые продукты, не указанные в рукописи.

    Несмотря на определенные преимущества морфологических методов, мы считаем, что наше исследование предоставляет доказательства того, что молекулярные методы, вероятно, более последовательно идентифицируют виды добычи, что дает возможность повысить точность и точность оценки рациона. Наш молекулярный тест был разработан только для карибу, лося и зайца-снегоступа; однако достижения в области секвенирования следующего поколения и подходов к штрих-кодированию ДНК демонстрируют большие перспективы, поскольку позволяют проводить один тест для многих видов добычи и / или растений, который может быть передан в разные системы (Valentini et al.2008; Де Барба и др. 2014а). Этот подход был бы особенно полезен в системах, где мало что известно о диете исследуемого организма, и, вероятно, увеличит вероятность обнаружения редких пищевых продуктов. Другие молекулярные исследования показали большие перспективы с использованием ПЦР в реальном времени для количественной оценки доли ДНК жертвы в помете в качестве показателя доли жертвы в рационе хищников (Matejusova et al. 2008; Bowles et al. 2011), что требует извлечения весь помет или обеспечение гомогенизации фекалий перед взятием под пробы.Хотя морфологический анализ использует аналогичный подход, оценивая долю объектов добычи в пометах, они могут быть скомпрометированы различиями в перевариваемости твердых частей, что создает необходимость в поправочных коэффициентах как для хищников, так и для конкретных жертв для оценки истинных пропорций (Hewitt и Роббинс 1996; Толлит и др. 1997). В конечном итоге молекулярные методы могут повысить точность анализа рациона и обеспечить более глубокое понимание того, как виды используют пищевые ресурсы и конкурируют за них, но дальнейшие исследования с использованием исследований контролируемого кормления с большим количеством объектов добычи будут иметь важное значение для проверки молекулярных методов.

    А cЗнания

    Это исследование финансировалось Департаментом окружающей среды и сохранения Ньюфаундленда и Лабрадора (Устойчивое развитие и стратегические науки и Институт биоразнообразия, экосистемных наук и устойчивости) и Международным фондом Safari Club. Мы благодарим C. Soulliere, R. Otto, T. Porter, S. Gullage, T. Hodder, J. McGinn, P. Tremblett, F. Norman, K. Lewis, A. Mouland, N. Rayl, а также Ньюфаундленд и Лабрадорский Департамент окружающей среды и охраны окружающей среды (Устойчивое развитие и стратегические науки и Институт биоразнообразия, экосистемных наук и устойчивости) для поддержки на местах.Мы благодарим Р. Толднесса, А. Гигли, М. Модлина и группу Waits Lab, а также Лабораторию экологической, эволюционной и природоохранной генетики за предоставленные рукописи и лабораторную поддержку. Мы также хотели бы поблагодарить Л. Пру, С. Прейндж и трех анонимных рецензентов за их проницательные комментарии.

    л итература

    Агрести

    А

    .

    1990

    .

    Категориальный анализ данных

    .

    Wiley

    ,

    Нью-Йорк

    8

    :

    244

    246

    .

    Прикладные биосистемы

    .

    2004

    .

    Genemapper 3.7

    .

    Applied Biosystems, Inc

    .,

    Фостер-Сити, Калифорния

    .

    Bowles

    E.

    Шульте

    П. М.

    Tollit

    Д. Дж.

    Deagle

    Б.E.

    Трит

    A. W.

    .

    2011

    .

    Долю съеденной добычи можно определить по фекальной ДНК с помощью ПЦР в реальном времени

    .

    Ресурсы молекулярной экологии

    11

    :

    530

    540

    .

    Каспер

    р. М.

    Джарман

    S. N.

    Deagle

    Б. Е.

    Галес

    N.J.

    Hindell

    М.А.

    .

    2007a

    .

    Обнаружение жертвы по ДНК в помете хищников: сравнение с морфологическим анализом с использованием Арктоцефал тюлени питались известной диетой

    .

    Журнал экспериментальной морской биологии и экологии

    347

    :

    144

    154

    .

    Каспер

    р. М.

    Джарман

    S. N.

    Галес

    N.J.

    Hindell

    М. А.

    .

    2007b

    .

    Объединение ДНК и морфологического анализа образцов фекалий улучшает понимание трофических взаимодействий: тематическое исследование с использованием универсального хищника

    .

    Морская биология

    152

    :

    815

    825

    .

    Дален

    Л.

    Эльмхаген

    Б.

    Ангербьорн

    А.

    .

    2004

    .

    Анализ ДНК фекалий лисицы и изменение ниши, вызванное конкуренцией

    .

    Молекулярная экология

    13

    :

    2389

    2392

    .

    Deagle

    Б. Е.

    Кьярадия

    А.

    Макиннес

    Дж.

    Джарман

    S. N.

    .

    2010

    .

    Пиросеквенирование фекальной ДНК для определения рациона маленьких пингвинов: что входит, что выходит?

    Сохранение генетики

    11

    :

    2039

    2048

    .

    Deagle

    Б. Е.

    и другие.

    2007

    .

    Изучение рациона морских птиц с помощью генетического анализа фекалий: тематическое исследование макаронных пингвинов (Eudyptes chrysolophus ). )

    .

    PLos Один

    2

    :

    e831

    .

    Deagle

    Б.E.

    Tollit

    Д. Дж.

    Джарман

    S. N.

    Hindell

    М. А.

    Трит

    A. W.

    Галес

    Н.J.

    .

    2005

    .

    Молекулярная копрология как инструмент изучения диеты: анализ ДНК жертвы в пометах звездных морских львов в неволе

    .

    Молекулярная экология

    14

    :

    1831

    1842

    .

    Де Барба

    М.

    и другие.

    2014a

    .

    Идентификация молекулярных видов нескольких плотоядных животных

    .

    Сохранение генетических ресурсов

    6

    :

    821

    824

    .

    Де Барба

    М.

    и другие.

    2014b

    .

    Мультиплексирование с метабаркодированием ДНК и проверка точности данных для оценки диеты: применение к всеядной диете

    .

    Ресурсы молекулярной экологии

    14

    :

    306

    323

    .

    Дуншеа

    G

    .

    2009

    .

    Анализ рациона на основе ДНК любого хищника

    .

    PLoS Один

    4

    :

    e5252

    .

    Францен

    М. А.

    Шелк

    Дж. Б.

    Фергюсон

    Дж.W. H.

    Уэйн

    Р. К.

    Кон

    м. Выс.

    .

    1998

    .

    Эмпирическая оценка методов сохранения фекальной ДНК

    .

    Молекулярная экология

    7

    :

    1423

    1428

    .

    Генные коды

    .

    2000

    .

    Sequencher® 4.7. Корпорация ген-кодов

    ,

    Анн-Арбор, Мичиган

    .

    Hewitt

    Д. Г.

    Роббинс

    C. T.

    .

    1996

    .

    Оценка пищевых привычек медведя гризли на основе анализа кала

    .

    Бюллетень Общества дикой природы

    24

    :

    547

    550

    .

    Клар

    U.

    Камлер

    Дж.F.

    Макдональд

    D. W.

    .

    2011

    .

    Сравнение и критика различных методов скат-анализа для определения диеты плотоядных

    .

    Обзор млекопитающих

    41

    :

    294

    312

    .

    Кон

    м.

    Knauer

    F.

    Stoffella

    А.

    Шредер

    Вт.

    Паабо

    С.

    .

    1995

    .

    Сохранение генетики европейского бурого медведя — исследование с использованием экскрементов ПЦР ядерных и митохондриальных последовательностей

    .

    Молекулярная экология

    4

    :

    94

    103

    .

    Латам

    А.Д. М.

    Латам

    М. С.

    Бойс

    М. С.

    Бутен

    С.

    .

    2013

    .

    Пространственные отношения симпатрических ( Canis lupus ) и койот ( С.латранс ) с лесным карибу ( Рангифер тарандус карибу ) в период отела в измененном человеком северном ландшафте

    .

    Исследования дикой природы

    40

    :

    250

    260

    .

    Льюис

    К.С.

    Махони

    С. П.

    .

    2014

    .

    Выживание, судьба и причины смертности карибу на Ньюфаундленде: сводка и анализ закономерностей и причин выживаемости и смертности карибу на Ньюфаундленде в период быстрого сокращения популяции (2003–2012 гг.)

    .

    Устойчивое развитие и стратегическая наука, Правительство Ньюфаундленда и Лабрадора, Санкт-Петербург.John’s, NL, технический бюллетень № 009

    :

    1

    50

    .

    Литвайтис

    J. A

    .

    2000

    .

    Изучение пищевых привычек наземных позвоночных

    . Стр.

    165

    190

    в

    Методы исследований в области экологии животных: противоречия и последствия

    ( Л.Бойтани и Т. К. Фуллер, ред.).

    Издательство Колумбийского университета

    ,

    Нью-Йорк

    .

    Маккей

    P.

    Смит

    Д. А.

    Длинный

    р.

    Паркер

    М.

    .

    2008

    .

    Собаки для обнаружения помета

    . Стр.

    183

    222

    в

    Неинвазивные методы обследования хищников

    ( Р.А.Лонг, ред.).

    Island Press

    ,

    Вашингтон, округ Колумбия

    .

    Мэддисон

    Вт.С.

    Мэддисон

    Д. р.

    .

    2003

    .

    MacClade 4: Анализ филогении и эволюции характера. Версия 4.06

    .

    Sinauer Associates

    ,

    Сандерленд, Массачусетс

    .

    Махони

    С.С.

    Водослив

    J. N.

    .

    2009

    .

    Синтез данных Карибу — Отчет о ходе работы. Обзор состояния лесного карибу на островном Ньюфаундленде: методология исследования, результаты, интерпретации и прогнозы на будущее

    .

    Устойчивое развитие и стратегическая наука, Правительство Ньюфаундленда и Лабрадора, Санкт-Петербург.John’s, NL, технический бюллетень № 001

    :

    1

    30

    .

    Matejusová

    I.

    и другие.

    2008

    .

    Использование количественной ПЦР в реальном времени для обнаружения добычи лососевых в помете серых Halichoerus grypus и тюленей Phoca vitulina в Шотландии — экспериментальное и полевое исследование

    .

    Журнал прикладной экологии

    45

    :

    632

    640

    .

    МакМанус

    г. E.

    Дерево

    C. H.

    .

    1991

    .

    Атлас Ньюфаундленда и Лабрадора

    .

    Волнорез, MUNCL

    ,

    St. John’s, Ньюфаундленд, Канада

    .

    Мельницы

    M. G. L

    .

    1992

    .

    Сравнение методов, используемых для изучения пищевых привычек крупных африканских хищников

    .Стр.

    1112

    1124

    в

    Дикая природа 2001: популяции

    ( Д. Р. Маккалоу и Р. Х. Баррет, ред.).

    Springer

    ,

    Нидерланды

    .

    Мельницы

    M. G. L

    .

    1996

    .

    Методологические достижения в исследованиях отлова, переписи и пищевых привычек крупных африканских хищников

    . Стр.

    223

    242

    в

    Поведение, экология и эволюция хищников

    ( Дж. Л. Гиттлман, ред.).

    Издательская ассоциация «Комсток»

    ,

    Лондон

    .

    Мумма

    М.А.

    Soulliere

    C. E.

    Махони

    С. П.

    Ожидание

    L. P.

    .

    2014

    .

    Углубленное понимание взаимоотношений хищник-жертва с использованием молекулярных методов для идентификации видов, особей и пола хищников

    .

    Ресурсы молекулярной экологии

    14

    :

    100

    108

    .

    Мерфи

    М. А.

    Ожидание

    L. P.

    Кендалл

    К.С.

    .

    2000

    .

    Количественная оценка методов сушки фекалий для анализа ДНК бурого медведя

    .

    Бюллетень Общества дикой природы

    28

    :

    951

    957

    .

    Онорато

    Д.

    Белый

    C.

    Загер

    P.

    Ожидание

    L. P.

    .

    2006

    .

    Обнаружение присутствия хищников на участках гибели лосей с использованием анализа мтДНК в образцах шерсти и помета

    .

    Бюллетень Общества дикой природы

    34

    :

    815

    820

    .

    Pegard

    А.

    и другие.

    2009

    .

    Универсальные ДНК-методы для оценки рациона пастбищного скота и диких животных по фекалиям

    .

    Журнал сельского хозяйства и пищевой химии

    57

    :

    5700

    5706

    .

    Райе

    г.

    Микель

    C.

    Coissac

    E.

    Реджадж

    C.

    Луизон

    А.

    Таберлет

    P.

    .

    2011

    .

    Новые данные о вариабельности рациона, выявленные с помощью штрих-кодирования ДНК и высокопроизводительного секвенирования: осенняя диета серны в качестве примера

    .

    Экологические исследования

    26

    :

    265

    276

    .

    Райл

    Н. Д.

    и другие.

    2014

    .

    Картирование распределения кормовых ресурсов: новорожденный карибу в Ньюфаундленде

    .

    Журнал маммологии

    95

    :

    328

    339

    .

    Основная группа разработчиков R

    .

    2014

    .

    R: язык и среда для статистических вычислений

    .

    R Фонд статистических вычислений

    ,

    Вена, Австрия

    .http://www.R-project.org/ . .

    Рейнольдс

    Дж. К.

    Эбишер

    N.J.

    .

    1991

    .

    Сравнение и количественная оценка рациона хищников с помощью анализа фекалий: критический анализ с рекомендациями, основанный на исследовании лисиц Vulpes vulpes

    .

    Обзор млекопитающих

    12

    :

    97

    122

    .

    Шехзад

    Вт.

    и другие.

    2012a

    .

    Хищные предпочтения снежного барса (Panthera uncia) в Южной Гоби, Монголия

    .

    PLoS Один

    7

    :

    e32104

    .

    Шехзад

    Вт.

    и другие.

    2012b

    .

    Анализ рациона хищников на основе секвенирования следующего поколения: применение к леопардовому коту (Prionailurus bengalensis ) ) в Пакистане

    .

    Молекулярная экология

    21

    :

    1951

    1965

    .

    Сполдинг

    р.

    Краусман

    P. R.

    Баллард

    Вт.Б.

    .

    2000

    .

    Систематическая ошибка наблюдателя и анализ рациона серого волка по пометам

    .

    Бюллетень Общества дикой природы

    28

    :

    947

    950

    .

    Стенглейн

    Дж.L.

    Де Барба

    м.

    Ausband

    Д. Е.

    Ожидание

    L. P.

    .

    2010

    .

    Влияние места отбора проб в фекалиях на качество ДНК у двух видов хищников

    .

    Ресурсы молекулярной экологии

    10

    :

    109

    114

    .

    Tollit

    Д. Дж.

    и другие.

    2009

    .

    Разработка и применение методов ДНК для проверки и уточнения оценок рациона ластоногих

    .

    Экологические приложения

    19

    :

    889

    905

    .

    Tollit

    Д. Дж.

    Стюард

    M. J.

    Томпсон

    стр.М.

    Пирс

    G. J.

    Сантос

    М. Б.

    Хьюз

    С.

    .

    1997

    .

    Различия между видами и размерами при переваривании отолитов и клювов: значение для оценки состава рациона ластоногих

    .

    Канадский журнал рыбных и водных наук

    54

    :

    105

    119

    .

    Валентини

    А.

    и другие.

    2009

    .

    Новые перспективы в анализе рациона на основе штрих-кодирования ДНК и параллельного пиросеквенирования: подход trnL

    .

    Ресурсы молекулярной экологии

    9

    :

    51

    60

    .

    Забала

    Дж.

    Zuberogoitia

    I.

    .

    2003

    .

    Барсук Мелес мелес (Mustelidae, Carnivora), диета, оцененная с помощью анализа ската: сравнение и критика различных методов

    .

    Folia Zoologica-PRAHA

    52

    :

    23

    30

    .

    Zeale

    М.Р.

    Бутлин

    Р. К.

    Баркер

    Г. Л. А.

    Лис

    Д. К.

    Джонс

    г.

    .

    2011

    .

    Таксон-специфическая ПЦР для ДНК-штрих-кодирования добычи членистоногих в фекалиях летучих мышей

    .

    Ресурсы молекулярной экологии

    11

    :

    236

    244

    .

    Заметки автора

    © 2015 Американское общество маммологов, www.

    LEAVE A RESPONSE

    Ваш адрес email не будет опубликован. Обязательные поля помечены *